United States
Germany
Japan
United Kingdom
China
Mafg (BC002092) Mouse Untagged Clone
CAT＃: MC206838
Mafg (untagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374),, (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AA545192; C630022N07Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206838 representing BC002092.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGACCCCCAATAAAGGAAACAAGGCCTTAAAGGTGAAGCGGGAGCCAGGCGAGAATGGCACCAGC TTGACCGACGAGGAGCTGGTAACCATGTCGGTGCGAGAGTTGAACCAGCACCTGCGAGGCCTCTCCAAG GAAGAGATCATCCAGCTGAAGCAGCGGAGGCGCACACTGAAGAACCGGGGCTACGCGGCCAGCTGCCGC GTCAAGCGGGTGACACAGAAGGAGGAGCTGGAGAAGCAGAAGGCGGAGCTCCAGCAGGAGGTGGAGAAG CTGGCCTCGGAGAATGCCAGCATGAAGCTGGAGCTCGATGCCCTGCGCTCCAAGTACGAGGCCCTGCAG AACTTTGCCAGGACCGTGGCCCGCAGCCCTGTGGCCCCAGCTCGGGGTCCCCTTGCTGCTGGCCTGGGG CCCCTGGTTCCTGGCAAGGTGGCTGCCACCAGCGTCATCACAATAGTAAAGTCCAAGACGGATGCTCGG TCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC002092 |
| Insert Size | 489 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002092 |
| RefSeq Size | 1357 bp |
| RefSeq ORF | 488 bp |
| Locus ID | 17134 |
| MW | 17.9 kDa |
| Gene Summary | Since they lack a putative transactivation domain, the small Mafs behave as transcriptional repressors when they dimerize among themselves (PubMed:16738329, PubMed:9679061). However, they seem to serve as transcriptional activators by dimerizing with other (usually larger) basic-zipper proteins, such as NFE2, NFE2L1 and NFE2L2, and recruiting them to specific DNA-binding sites (PubMed:16738329, PubMed:9679061). Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NFE2L2 transcription factor. Transcription factor, component of erythroid-specific transcription factor NFE2L2. Activates globin gene expression when associated with NFE2L2 (By similarity). May be involved in signal transduction of extracellular H(+) (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201268 | Mafg (tGFP-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374) |
CNY 2,850.00 |
|
| MR201268 | Mafg (Myc-DDK-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374) |
CNY 1,200.00 |
|
| MR201268L3 | Lenti ORF clone of Mafg (Myc-DDK-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374) |
CNY 4,750.00 |
|
| MR201268L4 | Lenti ORF clone of Mafg (mGFP-tagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374) |
CNY 4,750.00 |
