Hrg (BC011168) Mouse Untagged Clone

CAT#: MC206785

Hrg (untagged) - Mouse histidine-rich glycoprotein (cDNA clone MGC:19088 IMAGE:4195766), (10ug)



CNY 3,920.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms HPRG, HRGP, D16JH2, D18020
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for BC011168, the custom clone sequence may differ by one or more nucleotides


ATGAAGGTGCTCACCACAGCATTGCTTCTAGTCACCCTGCAGTGTTCCCATGCCCTGAGTCCCACCAACT
GTGATGCTTCTGAGCCTCTGGCTGAGAAAGTTCTAGACCTGATCAATAAAGGGCGGAGGAGTGGCTATGT
TTTCGAGCTGCTGCGGGTCTCTGACGCCCACTTGGACAGAGCGGGAACGGCCACAGTCTACTACTTAGCT
TTAGATGTGATAGAGTCTGACTGTTGGGTCCTTTCCACAAAAGCCCAGGATGACTGTCTTCCATCGAGGT
GGCAATCTGAAATAGTGATTGGACAATGTAAGGTAATAGCCACAAGATACTCAAATGAGTCTCAAGATCT
TAGCGTGAATGGCTATAACTGCACCACAAGTTCTGTCTCTTCAGCACTTCGCAATACCAAGGACAGTCCT
GTACTCTTGGACTTCTTTGAGGATTCCGAGCTCTACAGAAAGCAAGCCCGTAAAGCCCTGGACAAGTACA
AAACGGATAATGGTGACTTTGCCTCTTTCAGAGTGGAACGGGCAGAACGGGTTATAAGAGCGAGAGGAGG
GGAAAGAACCAATTACTATGTGGAATTCTCCATGAGGAACTGTTCCACACAGCATTTCCCCAGGTCCCCT
CTGGTCTTTGGATTCTGCAGAGCACTTTTGTCCTACAGTATAGAAACCTCTGACTTGGAAACCCCAGATT
CCATTGATATAAACTGCGAAGTCTTCAACATTGAGGATCATAAAGACACAAGTGACATGAAACCCCATTG
GGGCCATGAGCGTCCTCTTTGTGACAAACATCTGTGTAAGCTCAGTGGATCCAGGGATCATCATCATACC
CATAAGACAGATAAACTTGGATGCCCACCTCCACCAGAAGGAAAAGATAACTCAGACAGACCACGCCTTC
AAGAAGGAGCCCTTCCACAACTGCCCCCTGGCTATCCCCCTCATTCTGGTGCCAACAGAACCCATAGACC
CTCTTATAATCACAGTTGTAATGAGCATCCTTGTCATGGACATCGTCCCCATGGACACCACCCCCACAGT
CACCATCCCCCCGGTCACCATTCCCATGGTCACCATCCCCACGGTCACCATCCCCACAGTCACCATTCCC
ACGGTCACCATCCCCCCGGTCACCATCCCCATGGTCACCACCCCCACGGTCACCATCCCCATGGTCACCA
TCCCCACGGTCACCATCCTCATGGACATGACTTCCTTGACTATGGACCTTGTGACCCGCCCTCCAATAGT
CAAGAACTCAAAGGTCAGTATCATCGGGGCTATGGTCCACCACATGGACACTCAAGAAAAAGAGGTCCAG
GCAAAGGACTCTTTCCTTTCCACCACCAACAAATTGGATATGTCTACCGACTCCCTCCACTGAATATAGG
TGAAGTTCTCACTCTTCCTGAAGCCAATTTCCCCAGCTTCTCTTTGCCAAATTGCAACAGATCCCTACAA
CCAGAGATTCAGCCCTTCCCTCAGACAGCCTCCAGGTCATGTCCAGGGAAATTTGAGAGTGAATTTCCAC
AAATTTCCAAGTTTTTTGGATATACACCTCCAAAATAA


Restriction Sites RsrII-NotI     
ACCN BC011168
Insert Size 1578 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011168, AAH11168
RefSeq Size 1691 bp
RefSeq ORF 1578 bp
Locus ID 94175
Gene Summary Plasma glycoprotein that binds a number of ligands such as heme, heparin, heparan sulfate, thrombospondin, plasminogen, and divalent metal ions. Binds heparin and heparin/glycosaminoglycans in a zinc-dependent manner. Binds heparan sulfate on the surface of liver, lung, kidney and heart endothelial cells. Binds to N-sulfated polysaccharide chains on the surface of liver endothelial cells. Inhibits rosette formation. Acts as an adapter protein and is implicated in regulating many processes such as immune complex and pathogen clearance, cell chemotaxis, cell adhesion, angiogenesis, coagulation and fibrinolysis. Mediates clearance of necrotic cells through enhancing the phagocytosis of necrotic cells in a heparan sulfate-dependent pathway. This process can be regulated by the presence of certain HRG ligands such as heparin and zinc ions. Binds to IgG subclasses of immunoglobins containing kappa and lambda light chains with different affinities regulating their clearance and inhibiting the formation of insoluble immune complexes. Tethers plasminogen to the cell surface. Binds T-cells and alters the cell morphology. Acts as a regulator of the vascular endothelial growth factor (VEGF) signaling pathway; inhibits endothelial cell motility by reducing VEGF-induced complex formation between PXN/paxillin and ILK/integrin-linked protein kinase and by promoting inhibition of VEGF-induced tyrosine phosphorylation of focal adhesion kinases and alpha-actinins in endothelial cells. Also plays a role in the regulation of tumor angiogenesis and tumor immune surveillance. Normalizes tumor vessels and promotes antitumor immunity by polarizing tumor-associated macrophages, leading to decreased tumor growth and metastasis (By similarity). Modulates angiogenesis by blocking the CD6-mediated antiangiongenic effect of thrombospondins, THBS1 and THBS2.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...