Sirt5 (BC031770) Mouse Untagged Clone

CAT#: MC206573

Sirt5 (untagged) - Mouse sirtuin 5 (silent mating type information regulation 2 homolog) 5 (S. cerevisiae) (cDNA clone MGC:18762, (10ug)



CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610012J09Rik; 1500032M05Rik; AV001953
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031770
CTTTTTGCAGCCTGCCTGGGGAAGTAAGACTTCAACGAAAACCTGATGCGACCTCTCCTGATTGCTCCGG GCCGATTCATTTCCCAGTTGTGTTGTAGACGAAAGCCTCCTGCCTCCCCACAAAGCAAGATCTGCCTCAC CATGGCTCGTCCAAGTTCAAATATGGCAGACTTTCGGAAGTGTTTTGCGAACGCCAAGCACATAGCCATC ATCTCGGGGGCTGGCGTTAGTGCAGAGAGTGGGGTTCCCACTTTCAGAGGCGCTGGAGGTTACTGGAGAA AATGGCAGGCTCAGGACCTGGCAACCCCTCAGGCCTTTGCTCGAAACCCATCACAGGTGTGGGAGTTTTA CCACTACCGGAGGGAGGTCATGCGGAGCAAAGAACCCAACCCCGGGCACCTGGCCATTGCCCAGTGTGAA GCCCGGCTTCGTGACCAGGGCAGACGGGTTGTGGTCATCACCCAGAACATCGACGAGTTGCATCGCAAGG CTGGCACCAAGAACCTTCTGGAAATCCACGGAACCTTATTTAAAACTCGGTGTACCTCGTGTGGCACCGT TGCCGAGAACTATAGGAGTCCGATCTGCCCAGCTTTAGCAGGAAAAGGGGCCCCAGAGCCAGAGACTCAA GACGCCAGAATCCCAGTCGACAAACTTCCCCGGTGCGAGGAGGCAGGATGCGGAGGCTTGCTGCGACCTC ACGTGGTGTGGTTTGGAGAAAACCTAGATCCTGCCATTCTGGAGGAGGTGGACAGAGAGCTTGCCCTCTG TGACCTGTGTCTAGTGGTGGGAACATCCTCTGTGGTCTACCCGGCTGCCATGTTTGCCCCTCAGGTGGCT TCCAGGGGAGTCCCGGTGGCCGAGTTTAACATGGAGACCACCCCAGCCACCGACAGATTCAGGTTTCATT TTCCCGGACCCTGTGGGAAAACTCTTCCTGAAGCCCTTGCTCCTCATGAAACTGAAAGGACTTCTTAACC GCCCTGTGGAAAGAGGAGAAGGACCTGCAGTACGGTATCCTGGAGTGCTAAAGCAGGGCACTAACGGGAA AAATGGCTTTATGGATGGTGAGCTGAACTCTGGAAAAATATGGAAACACCCTTCAAGCCCCAAGCAGACA ATCTGTTACGTGATGGGTTTCAAAATACCAGCAGCAAATGTGTTTGATCTGGAAGAGGCTGTCAAGTCCT TCCATATTATTTGATTTGAACTGAAATATGAGTAATTGGGATTTGATATTTTTTGGTTAGTTACTGGAAG GGAAAATTTTGTAATTAAATTGCTTTAGAAGGCAATTATCCTGATTGTATGTTTGCATCTTGGGCAAAAA CAGAAAAAGAGAATTAAAACCCTGAAAGTTAAACCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA
Restriction Sites EcoRI-NotI     
ACCN BC031770
Insert Size 933 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC031770, AAH31770
RefSeq Size 1403 bp
RefSeq ORF 933 bp
Locus ID 68346
Gene Summary NAD-dependent lysine demalonylase, desuccinylase and deglutarylase that specifically removes malonyl, succinyl and glutaryl groups on target proteins (PubMed:23806337, PubMed:21908771, PubMed:22076378, PubMed:24315375, PubMed:24703693). Activates CPS1 and contributes to the regulation of blood ammonia levels during prolonged fasting: acts by mediating desuccinylation and deglutarylation of CPS1, thereby increasing CPS1 activity in response to elevated NAD levels during fasting (PubMed:19410549, PubMed:24703693). Activates SOD1 by mediating its desuccinylation, leading to reduced reactive oxygen species (By similarity). Activates SHMT2 by mediating its desuccinylation (By similarity). Modulates ketogenesis through the desuccinylation and activation of HMGCS2 (PubMed:24315375). Has weak NAD-dependent protein deacetylase activity; however this activity may not be physiologically relevant in vivo. Can deacetylate cytochrome c (CYCS) and a number of other proteins in vitro such as Uox (PubMed:23085393).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...