Vps4a (BC018368) Mouse Untagged Clone

CAT#: MC206490

Vps4a (untagged) - Mouse vacuolar protein sorting 4a (yeast) (cDNA clone MGC:11698 IMAGE:3963907), (10ug)



CNY 3,656.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MGC11698
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for BC018368, the custom clone sequence may differ by one or more nucleotides


ATGACAACGTCAACCCTCCAGAAAGCCATCGATCTGGTGACAAAAGCCACAGAAGAGGATAAAGCCAAGA
ACTACGAGGAGGCACTCCGTCTCTACCAGCATGCTGTGGAGTATTTCCTCCACGCCATCAAATATGAAGC
ACACAGTGACAAGGCCAAGGAGAGCATTCGAGCAAAGTGCATGCAGTACCTAGACAGAGCGGAGAAGCTG
AAGGATTATTTACGAAACAAAGAGAAACATGGCAAGAAGCCAGTCAAAGAGAACCAGAGTGAAGGCAAGG
GTAGTGACAGTGACAGTGAAGGGGATAATCCAGAGAAAAAGAAGTTACAAGAACAATTGATGGGTGCTGT
TGTGATGGAGAAGCCGAACATACGGTGGAATGATGTAGCTGGACTGGAGGGGGCTAAAGAGGCTCTCAAA
GAAGCTGTGATTTTGCCAATTAAATTCCCACACTTATTCACAGGCAAACGCACTCCTTGGCGAGGCATAC
TCCTCTTTGGGCCCCCAGGCACAGGCAAGTCCTACCTGGCCAAAGCCGTGGCAACAGAAGCCAACAACTC
TACCTTCTTCTCTGTGTCCTCCTCGGATCTGATGTCTAAGTGGTTGGGGGAAAGCGAGAAGCTAGTCAAG
AACCTGTTTGAGCTGGCCCGGCAGCATAAGCCTTCCATCATCTTCATTGATGAGGTAGATTCCCTCTGTG
GGTCACGGAATGAAAATGAGAGTGAAGCCGCTCGTAGGATCAAAACAGAGTTCTTGGTCCAGATGCAAGG
AGTGGGGAATAATAATGATGGAACTCTTGTTCTTGGTGCCACAAACATCCCCTGGGTGTTGGATTCAGCC
ATCAGGAGGAGGTTTGAAAAGCGAATTTATATCCCATTGCCAGAGGAAGCGGCCCGTGCCCAAATGTTTC
GGTTACATCTGGGAAGCACACCTCACAACCTCACAGATGCTAACATTCACGAGCTGGCCCGCAAGACAGA
AGGCTACTCAGGAGCAGATATCAGCATCATTGTGCGGGACTCCCTCATGCAGCCAGTCAGAAAAGTACAG
TCAGCAACACACTTCAAGAAGGTGTGTGGCCCTTCTCGAACCAACCCTAGCGTTATGATTGATGATCTTC
TGACCCCATGTTCTCCGGGAGATCCAGGGGCCATAGAGATGACTTGGATGGATGTCCCTGGTGATAAACT
CTTAGAGCCTGTGGTTTGCATGTCGGACATGCTCCGGTCTTTGGCCACTACCCGGCCCACAGTGAATGCA
GACGACCTCCTGAAAGTAAAGAAATTCTCTGAGGACTTTGGACAGGAGAGTTAA


Restriction Sites EcoRI-NotI     
ACCN BC018368
Insert Size 1314 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC018368, AAH18368
RefSeq Size 2089 bp
RefSeq ORF 1314 bp
Locus ID 116733
Gene Summary Involved in late steps of the endosomal multivesicular bodies (MVB) pathway. Recognizes membrane-associated ESCRT-III assemblies and catalyzes their disassembly, possibly in combination with membrane fission. Redistributes the ESCRT-III components to the cytoplasm for further rounds of MVB sorting. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. In conjunction with the ESCRT machinery also appears to function in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis. Involved in cytokinesis: retained at the midbody by ZFYVE19/ANCHR and CHMP4C until abscission checkpoint signaling is terminated at late cytokinesis. It is then released following dephosphorylation of CHMP4C, leading to abscission. VPS4A/B are required for the exosomal release of SDCBP, CD63 and syndecan (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...