C1qc (NM_007574) Mouse Untagged Clone
CAT#: MC205998
C1qc (untagged) - Mouse complement component 1, q subcomponent, C chain (C1qc), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI385742; C1qg; Ciqc |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC075724
GGAGAACAGGACGTCTCTGTGATTAGGCCTGAAGTCCCTTACACCCTCAGGATGGTCGTTGGACCCAGTT GCCAGCCTCCATGTGGACTTTGCCTGCTGCTGCTGTTTCTTCTGGCCCTACCACTCAGGAGCCAGGCCAG CGCTGGCTGCTATGGGATCCCAGGGATGCCAGGCATGCCGGGGGCCCCTGGGAAGGACGGGCATGATGGA CTCCAGGGGCCCAAGGGAGAGCCAGGAATCCCAGCCGTCCCTGGGACCCGAGGACCCAAGGGTCAGAAGG GCGAGCCTGGCATGCCTGGCCACCGTGGGAAAAATGGCCCTAGGGGGACCTCAGGGTTGCCAGGGGACCC AGGCCCCAGGGGGCCTCCGGGGGAGCCAGGTGTGGAGGGCCGATACAAACAGAAGCACCAGTCGGTATTC ACAGTCACCCGGCAGACCACCCAGTACCCAGAGGCCAACGCCCTCGTCAGGTTCAACTCTGTGGTCACCA ACCCTCAGGGGCATTACAACCCAAGCACAGGGAAGTTCACCTGTGAAGTGCCGGGCCTCTACTACTTCGT CTACTACACATCGCATACGGCCAACCTGTGCGTGCACCTGAACCTCAACCTTGCCAGGGTGGCCAGCTTC TGCGACCACATGTTCAACAGCAAGCAGGTCAGCTCCGGAGGAGTCCTCCTGCGGCTCCAGAGGGGCGACG AGGTGTGGCTATCAGTCAATGACTACAATGGCATGGTGGGCATAGAGGGCTCCAACAGCGTCTTCTCTGG TTTCCTACTGTTTCCCGACTAGAACGGCAGGCTGCTTCCAGCCCCCAGCCACCCACCTCGCTCCCTCTGC TTTCCCCATCCTCACTCAGACCTCTTCCTCCAGGAAGTCCACCCTGGTTCCTGATCCATCGGCCCTGTGT CTCCTCAGAGTTTCTCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGA CTATTTTTTTGTTCAGGTGGTGAGATAGAGAAATAAATAAATCCCTAAATAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007574 |
Insert Size | 741 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC075724, AAH75724 |
RefSeq Size | 1045 bp |
RefSeq ORF | 741 bp |
Locus ID | 12262 |
UniProt ID | Q02105 |
Gene Summary | C1q associates with the proenzymes C1r and C1s to yield C1, the first component of the serum complement system. The collagen-like regions of C1q interact with the Ca(2+)-dependent C1r(2)C1s(2) proenzyme complex, and efficient activation of C1 takes place on interaction of the globular heads of C1q with the Fc regions of IgG or IgM antibody present in immune complexes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203092 | C1qc (tGFP-tagged) - Mouse complement component 1, q subcomponent, C chain (C1qc) |
CNY 2,850.00 |
|
MR203092 | C1qc (Myc-DDK-tagged) - Mouse complement component 1, q subcomponent, C chain (C1qc) |
CNY 2,400.00 |
|
MR203092L3 | Lenti ORF clone of C1qc (Myc-DDK-tagged) - Mouse complement component 1, q subcomponent, C chain (C1qc) |
CNY 4,750.00 |
|
MR203092L4 | Lenti ORF clone of C1qc (mGFP-tagged) - Mouse complement component 1, q subcomponent, C chain (C1qc) |
CNY 4,750.00 |