United States
Germany
Japan
United Kingdom
China
Ang (NM_007447) Mouse Untagged Clone
CAT＃: MC205895
Ang (untagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI385586; An; Ang1; Rn; Rnase5; Rnase5a |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC055355
CCTGTCTCCAGGAGCACGCAGCTAGACACATTCCCAGTCGGAGGAAAGCTGGCCAGCTTTGGAATCTCTG TTGGAAGAGATGGCGATAAGCCCAGGCCCGTTGTTCTTGATCTTCGTGCTGGGTCTGGTTGTGATCCCTC CCACTCTGGCTCAGGATGACTCCAGGTACACAAAATTCCTGACTCAGCACCATGACGCCAAGCCAAAGGG CCGGGACGACAGATACTGTGAACGTATGATGAAGAGAAGAAGCCTAACCTCACCCTGCAAAGATGTCAAC ACCTTTATCCATGGCAACAAGAGCAACATCAAGGCCATCTGTGGAGCGAATGGAAGCCCTTACAGAGAAA ACTTAAGAATGAGCAAGTCTCCCTTCCAGGTCACCACTTGCAAGCACACAGGAGGGTCTCCCCGGCCTCC ATGCCAGTACCGAGCCTCTGCAGGGTTCAGACATGTTGTTATTGCCTGTGAGAATGGCTTGCCGGTCCAC TTCGATGAGTCATTTTTCAGTCTATAGTCAGCAGGCCCCTGGCACAGACCTAGCTATGTTTTCTTTTTAT CTCCCCTCATAGCCCAGAACACTGGTTCCAGCGTTCATTGTCAGGGGCCAGAAAAACGAACTATCTAAAA CATATGTCTCCTGATTTGCAATGCACAGAAATAAAGATGTCTCAAAAGCCAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007447 |
| Insert Size | 438 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC055355, AAH55355 |
| RefSeq Size | 695 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 11727 |
| UniProt ID | P21570 |
| Gene Summary | This gene encodes a member of the pancreatic ribonuclease A superfamily and is a potent inducer of neovascularization. The encoded protein is a secreted multifunctional tRNA-specific ribonuclease that promotes angiogenesis in response to angiogenetic stimuli such as hypoxia, mediates stress-induced translational repression by cleaving cellular tRNAs, stimulates cell proliferation by mediating rRNA transcription in prostate cancer cells, and is involved in neurite pathfinding. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the ribonuclease, RNase A family 4 gene. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. Multiple pseudogenes have been found for this gene. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200967 | Ang (tGFP-tagged) - Mouse angiogenin, ribonuclease A family, member 1 (Ang1) |
CNY 2,800.00 |
|
| MR200967 | Ang (Myc-DDK-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 |
CNY 1,200.00 |
|
| MR200967L3 | Lenti ORF clone of Ang (Myc-DDK-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 |
CNY 4,750.00 |
|
| MR200967L4 | Lenti ORF clone of Ang (mGFP-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 |
CNY 4,750.00 |
