Ap4s1 (NM_021710) Mouse Untagged Clone

CAT#: MC205886

Ap4s1 (untagged) - Mouse adaptor-related protein complex AP-4, sigma 1 (Ap4s1), (10ug)



  "NM_021710" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Ap4s1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI314282
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC053339
GGACGCCATGCTAAAAGCCAAAATGGCTGCCCCAAGGATGCCCGCAGCGCGCCGCCCGTGAGGAGGGAGC CGGGCGCGCCGTCACCGCTCGCCGGCCGGAGCGGCTCAGGTTCCAGCTACGGTCATCCAGTGCCATAACT TTTAAAGGATATTGCAAAGAAACTGGGAAAGGGTGAAAAAATGATCAAGTTTTTCCTTATGGTGAACAAG CAAGGGCAGACCCGACTGTCTAAGTACTACGAGCATGTGGACATTAATAAACGTGCGCTTCTGGAGACTG AGGTCAGCAAGAGTTGCCTGTCTCGGTCCAGCGAACAATGCTCATTCATTGAATACAAGGATTTTAAACT GATCTACCGGCAATATGCAGCTCTCTTTGTTGTGGTTGGAGTTAATGACACTGAGAATGAGATGGCTATC TATGAATTTATACACAATTTTGTGGAAGTTTTAGATGGGTACTTCAGCCGAGTGAGTGAATTAGATATAA TGTTTAATTTGGATAAAGTTCACATCATTTTGGATGAGATGGTGTTAAATGGCTGCATTGTGGAAACTAA CAGAGCCAGAATTCTTGCCCCTCTGCTGATTCTTGACAAGCTGTCGGAAAGCTGATGAAGACGATCAGGG TTTGAGTGCTGTGAAGGCCAAGGAAGAGATCATGGATGACAGCAGCCTTCTATAGTTCCTATCCCATAGT TCCTAAAGAGAAAACAATTCTTGTGTACACATTTTTCTCTTAACAGAGAGCCACAATTTTACTTGGTAAC TGTAAGCTTGCTTTTCCTTCTATAGGTACTGCAGGGTTGCAGTGTGATGCAAGCATGGCAGTTGTCCATC AGCCAATAAACTTCAAATTGACTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_021710
Insert Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC053339, AAH53339
RefSeq Size 895 bp
RefSeq ORF 435 bp
Locus ID 11782
UniProt ID Q9WVL1
Gene Summary This gene encodes the sigma subunit of the adaptor-related protein complex 4 which mediates intracellular membrane trafficking along the endocytic and secretory transport pathways. This complex contains four subunits, beta, epsilon, mu, and sigma, and belongs to a family of five adapter protein complexes, including three clathrin-associated complexes and two non clathrin-associated complexes, that localize to different intracellular compartments and mediate membrane vesicle trafficking using distinct pathways. In humans, loss-of-function mutations in this gene have been linked to specific adapter complex 4 deficiency disorders including hereditary spastic paraplegia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (2) uses two alternate splice sites in the 3' coding region, compared to variant 1, resulting in a novel 3' coding region and longer 3' UTR. It encodes isoform 2 which has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...