Ucp2 (NM_011671) Mouse Untagged Clone
CAT#: MC205697
Ucp2 (untagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3,600.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Slc25a8; UCP 2; UCPH |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012967
CCACGCGTCCGCACAATAGTATGAACTTTAAGTGTTTCGTCTCCCAGCCATTTTCTATGGAAAATCGAGG GGATCGGGCCATGGTAGCCACCGGCAGCTTTGAAGAACGAGACACCTTTAGAGAAGCTTGACCTTGGAGG CCTCAGCCTGAGACCTCAAAGCAGCCTCCAGAACTCCGGCAGAGTTCCTCTGTCTCGTCTTGCCGATTGA AGGTCCCCGTTTCTCCAATTTCTCTCCATCTTCTGGGAGGTAGCAGGAAATCAGAATCATGGTTGGTTTC AAGGCCACAGATGTGCCCCCAACAGCCACTGTGAAGTTCCTGGGGGCTGGGACAGCTGCCTGCATTGCAG ATCTCATCACTTTCCCTCTGGATACCGCCAAGGTCCGGCTGCAGATCCAAGGGGAGAGTCAAGGGCTAGT GCGCACCGCAGCCAGCGCCCAGTACCGTGGCGTTCTGGGTACCATCCTAACCATGGTGCGCACTGAGGGT CCACGCAGCCTCTACAATGGGCTGGTCGCCGGCCTGCAGCGCCAGATGAGCTTTGCCTCCGTCCGCATTG GCCTCTACGACTCTGTCAAACAGTTCTACACCAAGGGCTCAGAGCATGCAGGCATCGGGAGCCGCCTCCT GGCAGGTAGCACCACAGGTGCCCTGGCCGTGGCTGTAGCCCAGCCTACAGATGTGGTAAAGGTCCGCTTC CAGGCTCAGGCCCGGGCTGGTGGTGGTCGGAGATACCAGAGCACTGTCGAAGCCTACAAGACCATTGCAC GAGAGGAAGGGATCCGGGGCCTCTGGAAAGGGACTTCTCCCAATGTTGCCCGTAATGCCATTGTCAACTG TGCTGAGCTGGTGACCTATGACCTCATCAAAGATACTCTCCTGAAAGCCAACCTCATGACAGATGACCTC CCTTGCCACTTCACTTCTGCCTTCGGGGCCGGCTTCTGCACCACCGTCATCGCCTCCCCTGTTGATGTGG TCAAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCT CCGGAAGGAGGGACCCCGCGCCTTCTACAAGGGGTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAAC GTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAATGGCTGCCTACCAATCTCGGGAGGCAC CTTTCTGAGCCTCTCCATGCTGACCTGGACCCTGCTTCCCAGCCCTGCCCTGTCTTTTTCTTCATCCTCT GCCCAGTCCCATTCTCTTCCCATTTCCTGCACCCCGATTTACTTCCCACCTCACCTCCCTGTGCCTCTGT ACTGATGACTCACAGTGAGGAGGCCTGACACCAGACCCTGAGCCCTCAGCCCTTTCTACAGCTAAGCCCA CATCTTCATCTTCATCCCCAGCCCAGCCCAGCCCAGCTCAGCCAGCCTTCACCCATAAAGCAAGCTCAAT GTTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011671 |
Insert Size | 930 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC012967, AAH12967 |
RefSeq Size | 1488 bp |
RefSeq ORF | 930 bp |
Locus ID | 22228 |
UniProt ID | P70406 |
Gene Summary | UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Uncoupling protein 2 and aldolase B impact insulin release by modulating mitochondrial function and Ca2+ release from the ER
,null,
iScience
,PubMed ID 35800776
[Ucp2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204388 | Ucp2 (tGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2) |
CNY 4,000.00 |
|
MR204388 | Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
MR204388L1 | Lenti ORF clone of Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein |
CNY 5,890.00 |
|
MR204388L2 | Lenti ORF clone of Ucp2 (mGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein |
CNY 4,800.00 |
|
MR204388L3 | Lenti ORF clone of Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein |
CNY 5,890.00 |
|
MR204388L4 | Lenti ORF clone of Ucp2 (mGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein |
CNY 4,800.00 |