Smn1 (NM_011420) Mouse Untagged Clone

CAT#: MC205457

Smn1 (untagged) - Mouse survival motor neuron 1 (Smn1), (10ug)



  "NM_011420" in other vectors (4)

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI849087; Gemin1; Smn
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC045158
GCCATGGCGATGGGCAGTGGCGGAGCGGGCTCCGAGCAGGAAGATACGGTGCTGTTCCGGCGTGGCACCG GCCAGAGTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGCTTATGATAAAGCTGTGGCTTC CTTTAAGCATGCTCTAAAGAACGGTGACATTTGTGAAACTCCAGATAAGCCAAAAGGCACAGCCAGAAGA AAACCTGCCAAGAAGAATAAAAGCCAAAAGAAGAATGCCACAACTCCCTTGAAACAGTGGAAAGTTGGTG ACAAGTGTTCTGCTGTTTGGTCAGAAGACGGCTGCATTTACCCAGCTACTATTACGTCCATTGACTTTAA GAGAGAAACCTGTGTCGTGGTTTATACTGGATATGGAAACAGAGAGGAGCAAAACTTATCTGACCTACTT TCCCCGACCTGTGAAGTAGCTAATAGTACAGAACAGAACACTCAGGAGAATGAAAGTCAAGTTTCCACAG ACGACAGTGAACACTCCTCCAGATCGCTCAGAAGTAAAGCACACAGCAAGTCCAAAGCTGCTCCGTGGAC CTCATTTCTTCCTCCACCACCCCCAATGCCAGGGTCAGGATTAGGACCAGGAAAGCCAGGTCTAAAATTC AACGGCCCGCCGCCGCCGCCTCCACTACCCCCTCCCCCCTTCCTGCCGTGCTGGATGCCCCCGTTCCCTT CAGGACCACCAATAATCCCGCCACCCCCTCCCATCTCTCCCGACTGTCTGGATGACACTGATGCCCTGGG CAGTATGCTAATCTCTTGGTACATGAGTGGCTACCACACTGGCTACTATATGGGTTTCAGACAAAATAAA AAAGAAGGAAAGTGCTCACATACAAATTAAGAAGTTCAGCTCTGTCTCAGGAGATGGGGTGTCGGTGTCC CTGGTCGACAAGAACAGACGTCTCCTCGTCATCAGTGGACTCTTGGCTAAGTGGTGTCGTCATCAGCATC TCCCCGCTGTGGGAGTCCATCCATCCTAAGTCAGCAGCAGAGCGTGCCTGGGGCGTGAGCAGTTGGAGGG ACCGACCAGTGGAGTGTGCGTGTCGGAAGGCAGTCTACCCAGTCGTGACTGAGCACAAATGTGCAATTGT CATTTTCTTAGCATGTCAAGATTTTTATTAATGCCTTTAGAATTAAATAAAAGTCCTTTTTTGAAAAAAA AAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011420
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC045158, AAH45158
RefSeq Size 1198 bp
RefSeq ORF 867 bp
Locus ID 20595
UniProt ID P97801
Gene Summary The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus. Ensures the correct splicing of U12 intron-containing genes that may be important for normal motor and proprioceptive neurons development. Also required for resolving RNA-DNA hybrids created by RNA polymerase II, that form R-loop in transcription terminal regions, an important step in proper transcription termination. May also play a role in the metabolism of small nucleolar ribonucleoprotein (snoRNPs).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...