Cryga (NM_007774) Mouse Untagged Clone

CAT#: MC205177

Cryga (untagged) - Mouse crystallin, gamma A (Cryga), (10ug)



  "NM_007774" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cryg-; Cryg-4; DGcry-; DGcry-4; Sec; Secc
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC056430
GCTGTCAACAACGATGGGAAAGATCACCTTCTACGAGGACCGCGGCTTCCAGGGCCGCTGCTATGAGTGC AGCAGCGACTGCCCCAACCTGCAGACCTACTTCAGCCGCTGCAACTCCATCCGTGTGGACAGTGGCTGCT GGATGCTCTATGAGCGCCCCAACTACCAGGGCTACCAGTACTTCCTGCGTCGCGGGGACTACCCTGACTA CCAGCAGTGGATGGGTTTCAGCGACTCCATCCGCTCCTGCCGTTCCATTCCATACACCAGCTCTCACAGG ATAAGGCTTTATGAGAGAGATGACTACCGGGGCCTTGTGTCTGAGCTCATGGACGACTGTTCCTGCATCC ACGATCGCTTCCGCCTCCATGAGATCTACTCCATGCACGTGCTGGAGGGCTGCTGGGTCCTCTATGAGAT GCCCAACTACCGAGGCCGCCAATACCTGCTCAGGCCTGGAGACTACAGGCGCTACCACGACTGGGGCGCC ATGGATGCCAAGGTCGGCTCTCTGAGACGGGTCATGGATTTGTACTAAGCCTCCTTTTGCTTGTTACAGC CCATATATGCAATAAATAATCAACCTGTGTTCCTGGCAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_007774
Insert Size 525 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC056430, AAH56430
RefSeq Size 617 bp
RefSeq ORF 525 bp
Locus ID 12964
UniProt ID P04345
Gene Summary Three main families of major soluble proteins, the alpha, beta and gamma crystallins, are ubiquitously expressed in vertebrate lenses. This gene encodes a member of the gamma-crystallin family of proteins which may function as a structural component of the eye lens. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Five gamma-crystallin genes (gamma-A through gamma-E) are tandemly organized in a genomic segment as a gene cluster in the mouse. Another gamma-crystallin gene (gamma-F) is found some distance upstream of the cluster on the same chromosome. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...