Hdac8 (NM_027382) Mouse Untagged Clone

CAT#: MC205016

Hdac8 (untagged) - Mouse histone deacetylase 8 (Hdac8), (10ug)



  "NM_027382" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610007D20Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC061257
GGAGTCTGAAAACTGTTGGCTCCAGACTTTGGCTCGCGGACGGTTGGAAGTGGGAGATGGAGATGCCAGA GGAACCCGCCAACAGTGGGCATTCACTACCCCCGGTTTATATTTACAGTCCCGAGTATGTCAGCATCTGC GACTCCCTTGTGAAGGTCCCCAAACGGGCCAGTATGGTCCACTCTCTGATCGAAGCCTATGCCCTGCATA AACAAATGAGGATAGTGAAGCCCAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCCTA TCTGCAACATCTCCAGAAAGTCAGCCAAGAAGGTGATGAGGACCATCCAGACTCCATAGAATATGGACTA GGTTATGACTGCCCAGCCACAGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGAGGTACAATCACAG CTGCCCAGTGCCTGATTGACGGGAAGTGTAAAGTAGCCATCAACTGGTCTGGAGGGTGGCATCATGCAAA GAAAGATGAAGCATCTGGTTTCTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAA TTTGACCGTATTCTCTACGTGGATTTGGATCTACACCATGGAGATGGTGTAGAAGATGCCTTCAGTTTTA CATCGAAGGTTATGACTGTGTCCCTGCACAAGTTCTCCCCAGGATTTTTCCCAGGAACAGGTGACATGTC TGATGTTGGCCTGGGGAAAGGACGGTACTACAGTGTCAATGTGCCCATTCAGGATGGCATCCAGGATGAG AAGTACTATCACATCTGTGAAAGTGTACTAAAAGAAGTGTACCAGGCCTTCAATCCGAAGGCAGTGGTTT TACAGCTGGGAGCAGATACTATTGCCGGAGATCCAATGTGTTCCTTTAATATGACACCAGTGGGGATCGG CAAGTGTCTGAAGTATGTCCTACAGTGGCAGCTGGCAACTCTGATTTTAGGAGGAGGAGGCTATAACCTT GCCAACACGGCTCGTTGCTGGACATACTTGACCGGGGTCATCCTAGGGAAAACGCTATCCTCTGAGATCC CAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAATCACGCCAAGCTGCCGGCCAGA CCGCAATGAGCCCCACCGAATCCAGCAAATCCTCAACTACATCAAAGGGAATCTGAAGCATGTGGTCTAG TTGACAAAAAGAGATCAGGTTCCCAGAGCTGGGCAGCAGTGCCTATAATGAAGACAGTGTGTTGATGCAA GCGGTTTGTGGAATTTGTGACTGCAGGGGAAATTTGGAAGAAATTACTTCCTGAAAATTTCCAAGGGGCA CCAAGTGGCAGCTGGCCTCCTGGGGTGAGGAGCCAGGCACCCCGGAGCCAGGCCTAAGGGGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_027382
Insert Size 1134 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC061257, AAH61257
RefSeq Size 1421 bp
RefSeq ORF 1134 bp
Locus ID 70315
UniProt ID Q8VH37
Gene Summary Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Also involved in the deacetylation of cohesin complex protein SMC3 regulating release of cohesin complexes from chromatin. May play a role in smooth muscle cell contractility (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...