United States
Germany
Japan
United Kingdom
China
Gzma (NM_010370) Mouse Untagged Clone
CAT＃: MC204988
Gzma (untagged) - Mouse granzyme A (Gzma), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW494114; Ctla-3; Ctla3; Hf; Hf1; SE1; TSP-1; TSP1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC061146
ATCCCTGCTGATTGGGGTGGGAGAGCCACGATGAGGAACGCCTCTGGTCCCCGGGGGCCATCTCTTGCTA CTCTCCTTTTTCTTCTGCTTATTCCTGAAGGAGGCTGTGAAAGAATCATTGGAGGAGACACGGTTGTTCC TCACTCAAGACCGTATATGGCTCTACTTAAACTTAGTTCAAATACCATCTGTGCTGGCGCTTTGATTGAA AAGAACTGGGTGTTGACTGCTGCCCACTGTAACGTGGGAAAGAGATCTAAGTTCATTCTTGGGGCTCACT CAATCAATAAGGAGCCAGAACAACAGATATTGACTGTTAAGAAAGCATTTCCCTATCCATGCTATGATGA ATATACACGTGAGGGGGATCTACAACTTGTACGGCTAAAGAAAAAAGCAACAGTTAACAGAAATGTGGCT ATCCTTCACCTACCTAAAAAGGGAGATGATGTGAAACCAGGAACCAGATGCCGAGTAGCAGGATGGGGGA GATTTGGCAATAAGTCAGCTCCCTCTGAAACTCTGAGAGAAGTCAACATCACTGTCATAGACAGAAAAAT CTGCAATGATGAAAAACACTATAATTTTCATCCTGTAATTGGACTAAACATGATTTGTGCAGGGGACCTC CGTGGTGGAAAGGACTCCTGCAATGGGGATTCTGGCAGCCCTCTGCTATGTGATGGTATTTTGCGAGGCA TCACCTCTTTTGGTGGAGAGAAGTGTGGAGATCGCCGATGGCCTGGTGTCTATACTTTCCTCTCAGATAA ACACCTCAATTGGATAAAGAAGATTATGAAGGGTTCTGTGTAAATGTATGTCTTTCACTCCATCCCTGTC ACTTCTGTGTCTGATCACAAATAAAATCAACTTGAATGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_010370 |
| Insert Size | 783 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC061146, AAH61146 |
| RefSeq Size | 910 bp |
| RefSeq ORF | 783 bp |
| Locus ID | 14938 |
| UniProt ID | P11032 |
| Gene Summary | Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent cell death with morphological features of apoptosis when delivered into the target cell through the immunological synapse. It cleaves after Lys or Arg. Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity. Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203381 | Gzma (tGFP-tagged) - Mouse granzyme A (Gzma) |
CNY 2,850.00 |
|
| MR203381 | Gzma (Myc-DDK-tagged) - Mouse granzyme A (Gzma) |
CNY 2,400.00 |
|
| MR203381L3 | Lenti ORF clone of Gzma (Myc-DDK-tagged) - Mouse granzyme A (Gzma) |
CNY 4,750.00 |
|
| MR203381L4 | Lenti ORF clone of Gzma (mGFP-tagged) - Mouse granzyme A (Gzma) |
CNY 4,750.00 |
