United States
Germany
Japan
United Kingdom
China
Ndufab1 (NM_028177) Mouse Untagged Clone
CAT＃: MC204981
Ndufab1 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 8kDa; 2210401F17Rik; 2310039H15Rik; 2610003B19Rik; 9130423F15Rik; ACP; CI-SDAP; SDAP |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC060951
ATCCTGGGTTGGCGTAGCCATGGCGTCTCGTGTCCTCTGCGCCTGTGTCCGCCGCCTGCCCGCGGCCTTC GCGCCGCTGCCCCGGCTTCCCACGTTGGCCTTGGCGCGGCCGCTCAGCACCACCCTATGCCCTGAGGGAA TCCGGAGGAGACCCGGGGCTCTGCAGTCCGCCTTGGCGCTCGCGCAGGTGCCTGGAACAGTCACACATTT GTGCCGCCAGTACAGTGACGCACCCCCACTGACGTTAGACGGAATCAAGGACCGAGTTCTGTATGTCTTG AAACTCTATGATAAGATTGATCCAGAAAAGCTCTCCGTAAATTCTCATTTTATGAAGGACCTGGGCTTAG ACAGTTTGGACCAAGTGGAAATTATTATGGCCATGGAAGACGAATTTGGGTTTGAAATTCCTGATATAGA TGCAGAGAAGTTAATGTGTCCACAAGAAATTGTAGATTACATTGCAGATAAGAAGGATGTGTATGAATAA AGTATCAGAGCCTTCTTCCTCACTGTGAGGACTCCAGAGGACACACGATGGCATCGTGGCCGACTGACAG CGGCTCTGTTCAACTTGTATTTAAATTGTCTGAGTGTTTTACCCGTTAAAAATAAATCTATTACAAAACA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_028177 |
| Insert Size | 471 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC060951, AAH60951 |
| RefSeq Size | 659 bp |
| RefSeq ORF | 471 bp |
| Locus ID | 70316 |
| UniProt ID | Q9CR21 |
| Gene Summary | Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity). Accessory and non-catalytic subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201172 | Ndufab1 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1) |
CNY 3,420.00 |
|
| MG215726 | Ndufab1 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha/beta subcomplex 1 (Ndufab1) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2,850.00 |
|
| MR215726 | Ndufab1 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
| MR215726L3 | Lenti ORF clone of Ndufab1 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR215726L4 | Lenti ORF clone of Ndufab1 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 (Ndufab1), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
其它Ndufab1产品
