Fgf21 (NM_020013) Mouse Untagged Clone
CAT#: MC204941
Fgf21 (untagged) - Mouse fibroblast growth factor 21 (Fgf21), (10ug)
CNY 2,400.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC049592
GACAGCCTTAGTGTCTTCTCAGCTGGGGATTCAACACAGGAGAAACAGCCATTCACTTTGCCTGAGCCCC AGTCTGAACCTGACCCATCCCTGCTGGGCACCGGAGTCAGAACACAATTCCAGCTGCCTTGGCTCCTCAG CCGCTCGCTTGCCAGGGGCCCTCCCGAACGGAGCGCAGCCCTGATGGAATGGATGAGATCTAGAGTTGGG ACCCTGGGACTGTGGGTCCGACTGCTGCTGGCTGTCTTCCTGCTGGGGGTCTACCAAGCATACCCCATCC CTGACTCCAGCCCCCTCCTCCAGTTTGGGGGTCAAGTCCGGCAGAGGTACCTCTACACAGATGACGACCA AGACACTGAAGCCCACCTGGAGATCAGGGAGGATGGAACAGTGGTAGGCGCAGCACACCGCAGTCCAGAA AGTCTCCTGGAGCTCAAAGCCTTGAAGCCAGGGGTCATTCAAATCCTGGGTGTCAAAGCCTCTAGGTTTC TTTGCCAACAGCCAGATGGAGCTCTCTATGGATCGCCTCACTTTGATCCTGAGGCCTGCAGCTTCAGAGA ACTGCTGCTGGAGGACGGTTACAATGTGTACCAGTCTGAAGCCCATGGCCTGCCCCTGCGTCTGCCTCAG AAGGACTCCCCAAACCAGGATGCAACATCCTGGGGACCTGTGCGCTTCCTGCCCATGCCAGGCCTGCTCC ACGAGCCCCAAGACCAAGCAGGATTCCTGCCCCCAGAGCCCCCAGATGTGGGCTCCTCTGACCCCCTGAG CATGGTAGAGCCTTTACAGGGCCGAAGCCCCAGCTATGCGTCCTGACTCTTCCTGAATCTAGGGCTGTTT CTTTTTGGGTTTCCACTTATTTATTACGGGTATTTATCTTATTTATTTATTTTAGTTTTTTTTTCTTACT TGGAATAATAAAGAGTCTGAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_020013 |
Insert Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC049592, AAH49592 |
RefSeq Size | 997 bp |
RefSeq ORF | 633 bp |
Locus ID | 56636 |
UniProt ID | Q9JJN1 |
Gene Summary | Stimulates glucose uptake in differentiated adipocytes via the induction of glucose transporter SLC2A1/GLUT1 expression (but not SLC2A4/GLUT4 expression). Activity probably requires the presence of KLB.[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Retinoic Acid Receptor ß Stimulates Hepatic Induction of Fibroblast Growth Factor 21 to Promote Fatty Acid Oxidation and Control Whole-body Energy Homeostasis in Mice
,Yu Li, Kimberly Wong, Kenneth Walsh, Bin Gao, and Mengwei Zang,
J. Biol. Chem., Apr 2013; 288: 10490 - 10504.
,PubMed ID 23430257
[FGF21]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202264 | Fgf21 (tGFP-tagged) - Mouse fibroblast growth factor 21 (Fgf21) |
CNY 4,000.00 |
|
MR202264 | Fgf21 (Myc-DDK-tagged) - Mouse fibroblast growth factor 21 (Fgf21) |
CNY 2,400.00 |
|
MR202264L3 | Lenti ORF clone of Fgf21 (Myc-DDK-tagged) - Mouse fibroblast growth factor 21 (Fgf21) |
CNY 4,800.00 |
|
MR202264L4 | Lenti ORF clone of Fgf21 (mGFP-tagged) - Mouse fibroblast growth factor 21 (Fgf21) |
CNY 4,800.00 |