United States
Germany
Japan
United Kingdom
China
Pin1 (NM_023371) Mouse Untagged Clone
CAT＃: MC204855
Pin1 (untagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1), (10ug)
CNY 1,200.00
CNY 2,000.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610025L01Rik; D9Bwg1161e |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC038254
CCACGCGTCCGGGGAAGATGGCGGACGAGGAGAAGCTGCCACCAGGCTGGGAGAAGCGTATGAGTCGCAG CTCAGGCCGGGTGTACTACTTCAATCACATCACCAACGCCAGCCAGTGGGAGCGGCCCAGCGGCGGCAGC ACTGTTGGAGGCAGCAGCAAGAATGGCCAGGGTGAGCCTGCCAAGGTGCGCTGCTCACATCTGCTGGTGA AGCACAGCCAGTCTCGGAGGCCCTCATCCTGGCGGCAGGAAAAGATCACCAGGAGCAAGGAGGAGGCCCT GGAGCTCATCAATGGCTATATCCAGAAGATTAAGTCAGGAGAGGAAGACTTTGAATCTCTGGCCTCACAG TTCAGTGATTGCAGCTCTGCCAAAGCCAGGGGAGACCTGGGTCCCTTCAGCAGAGGTCAGATGCAGAAAC CATTTGAGGATGCGTCGTTTGCTCTACGGACAGGGGAGATGAGTGGGCCCGTGTTCACGGACTCGGGCAT CCATATCATCCTGCGCACAGAATGAGGGCAGGCACCTGGCCAGCCTGCTCTGGCTGCCACACAGCCCACG GATGCCCTTCCTGCTACTGTCACACAGTATTTATTGTTCCTAAAATGACTGGGAGGGGCTCTGAGCATCC CGCTCCCTGTTTGCCCCTATTCGGGGCTGTCCTAGCCAGGCTCCTTCTGGAGGAATTGACTTCAGAAGGG CAGTGGGGATGGGGAGGCCCCCAGGCTCAGGGGGTCAGAGGTGACCTGATCCCCCAGGTCTCAGAGGCAG GCAGGAGGGCCTTCTTTCTTGTTAGTTATATGCTCCATTCGTTCCTCTGTTCAGTTGCAAAAAGCAGACG CTCCATACCTGGCGGTGCAGCAACTCAGCCTCAGGGTGCAGTGCAGCACCCTACGCACCTTCCATTAAAT CTGGAACCACTAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_023371 |
| Insert Size | 498 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC038254, AAH38254 |
| RefSeq Size | 936 bp |
| RefSeq ORF | 498 bp |
| Locus ID | 23988 |
| UniProt ID | Q9QUR7 |
| Gene Summary | Peptidyl-prolyl cis/trans isomerase (PPIase) that binds to and isomerizes specific phosphorylated Ser/Thr-Pro (pSer/Thr-Pro) motifs. By inducing conformational changes in a subset of phosphorylated proteins, acts as a molecular switch in multiple cellular processes. Displays a preference for an acidic residue N-terminal to the isomerized proline bond. Regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. Down-regulates kinase activity of BTK. Can transactivate multiple oncogenes and induce centrosome amplification, chromosome instability and cell transformation. Required for the efficient dephosphorylation and recycling of RAF1 after mitogen activation (By similarity). Binds and targets PML and BCL6 for degradation in a phosphorylation-dependent manner (PubMed:17828269). Acts as a regulator of JNK cascade by binding to phosphorylated FBXW7, disrupting FBXW7 dimerization and promoting FBXW7 autoubiquitination and degradation: degradation of FBXW7 leads to subsequent stabilization of JUN (By similarity). May facilitate the ubiquitination and proteasomal degradation of RBBP8/CtIP through CUL3/KLHL15 E3 ubiquitin-protein ligase complex, hence favors DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR) (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Hyperthermia stress activates heat shock protein expression via propyl isomerase 1 regulation with heat shock factor 1
,Wang, HY;Fu, JC;Lee, YC;Lu, PJ;,
Mol Cell Biol. 2013 Dec;33(24):4889-4899
,PubMed ID 24126052
[PIN1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201342 | Pin1 (tGFP-tagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1) |
CNY 2,850.00 |
|
| MR201342 | Pin1 (Myc-DDK-tagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1) |
CNY 1,200.00 |
|
| MR201342L3 | Lenti ORF clone of Pin1 (Myc-DDK-tagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1) |
CNY 4,750.00 |
|
| MR201342L4 | Lenti ORF clone of Pin1 (mGFP-tagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1) |
CNY 4,750.00 |
