United States
Germany
Japan
United Kingdom
China
Sncg (NM_011430) Mouse Untagged Clone
CAT＃: MC204690
Sncg (untagged) - Mouse synuclein, gamma (Sncg), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | C79089; persyn |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC028508
GCAGTAGCAGCAGAGACAGCGGCTGCGGCAGCACTCCAGTCCATAGCTTGCAGCAGCCAGGTTCCATCCT TGCAAACACCATGGACGTCTTCAAGAAAGGCTTCTCCATTGCCAAGGAAGGTGTTGTGGGTGCTGTAGAA AAGACCAAGCAGGGAGTAACGGAGGCAGCTGAGAAGACCAAGGAGGGGGTTATGTATGTGGGCACCAAAA CCAAGGAGAACGTGGTACAAAGTGTCACCTCAGTGGCTGAGAAGACCAAGGAGCAGGCCAATGCCGTGAG TGAAGCTGTGGTCAGCAGCGTCAACACAGTGGCCAACAAGACCGTGGAGGAGGCTGAAAACATCGTGGTC ACCACCGGGGTGGTGCGCAAGGAGGACTTGGAACCCCCTGCACAGGACCAAGAAGCCAAAGAGCAAGAGG AGAATGAAGAGGCCAAGAGTGGAGAAGACTAGAAGGCTGCCAGCCAACCACAGAGGCTCAAGGGACACCC CTCTGCCTTGGACCCTGTCTCAACCTGGCACACTGAATGCCCTGCCTAGAGTGCCCTGCAGGTTGCCCAA GTTCTCTGTCCCTAGCCCAGTGCCACAAGTCCACACACGCTACTGCCAGCGCCAGCACCCCCTGCTGGCT CCTTTTACCCTATGGTCCTCTGATCACCAATCAGATGCTGCTGTGATTTCTTTTTTTTTAATGATTCCAA ATAAAACCTGAGCCCCACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_011430 |
| Insert Size | 372 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028508, AAH28508 |
| RefSeq Size | 748 bp |
| RefSeq ORF | 372 bp |
| Locus ID | 20618 |
| UniProt ID | Q9Z0F7 |
| Gene Summary | Plays a role in neurofilament network integrity. May be involved in modulating axonal architecture during development and in the adult. In vitro, increases the susceptibility of neurofilament-H to calcium-dependent proteases. May also function in modulating the keratin network in skin. Activates the MAPK and Elk-1 signal transduction pathway (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200624 | Sncg (tGFP-tagged) - Mouse synuclein, gamma (Sncg) |
CNY 2,850.00 |
|
| MR200624 | Sncg (Myc-DDK-tagged) - Mouse synuclein, gamma (Sncg) |
CNY 1,200.00 |
|
| MR200624L3 | Lenti ORF clone of Sncg (Myc-DDK-tagged) - Mouse synuclein, gamma (Sncg) |
CNY 4,750.00 |
|
| MR200624L4 | Lenti ORF clone of Sncg (mGFP-tagged) - Mouse synuclein, gamma (Sncg) |
CNY 4,750.00 |
