Cldn7 (NM_016887) Mouse Untagged Clone

CAT#: MC204654

Cldn7 (untagged) - Mouse claudin 7 (Cldn7), transcript variant 1, (10ug)



  "NM_016887" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC050007
CCTGCCGCCGCACCGCCAGCTCCCTGTGCCGCGCACCGCAGCCTGGGGCCCAAGGGCCCGCATACTTTCT GGGGGCCACGCCCTAACGGCCCCTCCACTTCTTTGGGTAGTCTCGGAGCACGCCGGTAGGAACCGCCCGG CCTTCGGGGACCGCTTTTGTCTGGAACCAGTCCTTCGGGCGAAGCCGGTTCCCTCTGCTGTGAGAGTGTC GCTTCACCGGAGGGGACGATTTGTGTTTACCTCGGTTAACAAGATTTGTAGTTACCCGGTCCAAAAAAAA ATCTTTTTCTCCTTTGGGTGACTTAAATCTCTATCCAAATTTTCTTGTGTTGCTGCTCCCCGGATTTTTG TTTTTTTGTTTTTTTGCTTTACTGTAGGGTCGCCCTCCCGGCGCGTCCCGTCTTTTCTGAGACAAGGAAA TGGCCAACTCGGGCCTGCAACTGCTGGGCTTTTCAATGGCCATGCTTGGCTGGGTGGGCCTGATAGCGAG CACTGCCATCCCTCAGTGGCAGATGAGCTCCTATGCGGGCGACAACATCATCACAGCCCAGGCCATGTAC AAGGGGCTCTGGATGGAGTGCGTCACGCAGAGCACCGGCATGATGAGCTGCAAAATGTACGACTCGGTGC TCGCCCTGCCGGGAGCCCTGCAGGCCACTCGAGCCTTAATGGTGGTGTCCCTGGTGTTGGGCTTCTTAGC CATGTTTGTCGCCACGATGGGCATGAAGTGCACACGCTGTGGGGGAGATGACAAAGCGAAGAAGGCCCGA ATAGCTATGACTGGAGGCATTGTTTTCATTGTGGCAGGTCTTGCTGCCTTGGTAGCATGTTCCTGGATTG GTCATCAGATTGTCACAGACTTTTATAACCCCTTGACGCCCATGAACGTTAAGTACGAGTTTGGACCTGC CATCTTTATCGGCTGGGCAGGGTCTGCTCTGGTCCTTCTGGGAGGTGCCCTGCTCTCTTGCTCCTGTCCA GGCAGTGAAAGCAAAGCTGCGTACCGAGCACCCCGCTCTTACCCCAAGTCCAATTCCTCCAAGGAATACG TGTGAGCTGGGGAGCCCAGCCTGCGGGCAGGGTGGGAGGCAAAGGCCTCCTGGCCACTCCACCTCCAAAC ATCATGTATAGTTTGCTTGGGGGGAGGGCAGTTGGGGGGTTACTGGGAGAGGAAGACATGGGGTGTGCTT TTGTACAGAAATAAAATTAAGTTTTGGAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_016887
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC050007, AAH50007
RefSeq Size 1235 bp
RefSeq ORF 636 bp
Locus ID 53624
UniProt ID Q9Z261
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed constitutively in the mammary epithelium throughout development, and might be involved in vesicle trafficking to the basolateral membrane. It is essential for NaCl homeostasis in distal nephrons. The knockout mice lacking this gene showed severe salt wasting, chronic dehydration, and growth retardation, and died within 12 days after birth. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (1) and variant 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...