Dtnbp1 (NM_025772) Mouse Untagged Clone
CAT#: MC204576
Dtnbp1 (untagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1), (10ug)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5430437B18Rik; AW048963; Bloc1s8; dysbindin; sdy |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC018350
GCCGGGGAGGCTGCGGCGGCGGCGGCGCGGTGAAGCGAGAGCCGACGCGCGGGGCGAGGGGACGCCCGAC GGCGTCCGAGGGCGCGGTGGCGCGAGGCCTGAGGGAGGGGACGCGATGCTGGAGACCCTGCGCGAGCGGC TGCTGAGCGTACAGCAGGATTTCACCTCCGGGCTGAAGACTTTAAGTGATAAGTCAAGAGAAGCAAAAGT GAAAGGCAAACCCAGGACTGCTCCACGCTTACCGAAGTACTCTGCTGGACTAGAATTACTTAGCAGGTAT GAGGATGCGTGGGCTGCACTTCACAGAAGAGCCAAGGAGTGTGCAGACGCTGGCGAGCTGGTGGACAGCG AGGTGGTCATGCTGTCTGCCCACTGGGAGAAGAAGAGGACCAGCCTGAACGAGCTGCAGGGGCAGCTGCA GCAGCTGCCCGCTCTCCTGCAGGACTTGGAGTCTCTGATGGCAAGCCTGGCTCATTTAGAGACAAGTTTT GAAGAGGTAGAGAACCATTTGCTGCACCTGGAGGACTTGTGTGGGCAGTGTGAGTTAGAAAGACACAAGC AGGCCCAGGCCCAACACCTGGAGAGCTACAAGAAAAGTAAGAGGAAGGAGCTTGAAGCCTTCAAAGCTGA ACTCGATACAGAGCACACACAGAAGGCCCTGGAAATGGAGCACACCCAGCAACTGAAGCTGAAGGAGCGG CAGAAGTTCTTCGAGGAAGCCTTCCAGCAGGACATGGAACAGTACCTGTCCACGGGCTACCTGCAGATCG CAGAGAGGCGAGAGCCTATGGGCAGCATGTCATCCATGGAAGTGAATGTGGACGTGCTGGAGCAGATGGA CCTGATGGACATCTCAGACCAGGAGGCTCTCGATGTCTTCCTGAACTCCGGCGGAGAGGACAACATTGTG ATGTCCCCTGGTGTGGAGATGGAATCCAACCCCAATCAGAATGAAATGAGTCTTCAGATTCCAAGTCCCT CAGAATCAGCATCCCAGCCACCTGCCTCACCCTCTGCCTGCACTGACCTGGACACTGCTGATGCCCCCCT CATCCAGTCTGATGAGGAGGAGGTACAGGTGGACACGGCCTTGGTCACATTACACACTGACAGAAAGTCC ACCCCAGGTGTCAGTGATGACAGTGACCAGTGTGACTCAACTCAGGACATTTAAGTGACTTGTCAGCTGT GCGCAGAATCCTCCTGCAAAGCCAGGTGCTTAGAGGTTTTCAATTTTACACACTTGCTAATGGGATGTAA GAACCATTAGAGAAGCGCTCACAATAAAGCTTATGGAATAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025772 |
Insert Size | 1059 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC018350, AAH18350 |
RefSeq Size | 1314 bp |
RefSeq ORF | 1059 bp |
Locus ID | 94245 |
UniProt ID | Q91WZ8 |
Gene Summary | Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes. In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals. The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension. Associates with the BLOC-2 complex to facilitate the transport of TYRP1 independent of AP-3 function. Plays a role in synaptic vesicle trafficking and in neurotransmitter release. Plays a role in the regulation of cell surface exposure of DRD2. May play a role in actin cytoskeleton reorganization and neurite outgrowth. May modulate MAPK8 phosphorylation. Appears to promote neuronal transmission and viability through regulating the expression of SNAP25 and SYN1, modulating PI3-kinase-Akt signaling and influencing glutamatergic release. Regulates the expression of SYN1 through binding to its promoter. Modulates prefrontal cortical activity via the dopamine/D2 pathway.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG205351 | Dtnbp1 (tGFP-tagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1) |
CNY 7,088.00 |
|
MR205351 | Dtnbp1 (Myc-DDK-tagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1) |
CNY 5,488.00 |
|
MR205351L3 | Lenti ORF clone of Dtnbp1 (Myc-DDK-tagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1) |
CNY 5,230.00 |
|
MR205351L4 | Lenti ORF clone of Dtnbp1 (mGFP-tagged) - Mouse dystrobrevin binding protein 1 (Dtnbp1) |
CNY 5,230.00 |