Gtf3a (NM_025652) Mouse Untagged Clone

CAT#: MC204444

Gtf3a (untagged) - Mouse general transcription factor III A (Gtf3a), (10ug)



  "NM_025652" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010015D03Rik; 2610111I01Rik; 5330403M05Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC032292
CCACGCGTCCGCCTTCATCAGAGACTACCATCTGAGCCGGCATGTCCTGATTCACACCGGGGAAAAGCCG TTTGTTTGTGCAGATGATGGCTGTAATCAGAAATTCAACACAAAATCAAACTTGAAGAAACACATTGAAC GCAAACATGGAAACCCACAAAAACAGTATGTGTGCAGTTATGAGGGTTGCAAGAAGGCCTTTAAGAAGCA CCAGCAGCTGAGAACCCATCAGTGCCAGCACACCAGCGAGCCACTCTTCAGGTGTACCCACGAGGGATGC GGGAAGCACTTTGCCTCGCCCAGCAGGCTGAAACGGCATGGGAAAGTTCACGAGGGCTACCTGTGTCAAA AGGGATGTTCTTTCATGGGAAAAACGTGGACAGAGCTTCTGAAACACATGAGAGAAGCCCATAAAGAGGA CATAACCTGCAACGTATGTCAGAGGATGTTCAAGCGCAGAGATTACCTTAAGCAGCACATGAAGACTCAC GCCCCGGAAAGGGATGTGTACCGCTGTCCGCGGCAAGGCTGCGGAAGAACCTACACAACCGTGTTCAACC TGCAGAGCCACATTCTCTCCTTCCACGAGGAAAAGCGCCCATTTGTGTGTGAGCACGCTGGCTGTGGCAA GACATTCGCAATGAAACAGAGTCTCATGAGGCACAGTGTCGTGCACGATCCCGACAAGAAGAGGATGAAG CTCAAAGTAAGAGCCCCTCGGGAGAGACGCAGCTTGGCCTCTCGCCTCAGTGGGTACTTCCCTCCTAAGA GGAAACAAGAGCCCGACTACTCCTTGCCTAACGCCAGCGCAGAGTCCAGCAGCAGTCCAGAGGCCCAGCT GCCCCCGCCAGCCACCTTACTCACTGTCTGCTAGGCGGGAAGACTTCAGGGCGGCCGGCAGAGGCTCCTG GCCTGCACTTTTCCTATTAAAGTCACTGACACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025652
Insert Size 510 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC032292, AAH32292
RefSeq Size 996 bp
RefSeq ORF 510 bp
Locus ID 66596
UniProt ID Q8VHT7
Gene Summary The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...