Higd1a (NM_019814) Mouse Untagged Clone

CAT#: MC204148

Higd1a (untagged) - Mouse HIG1 domain family, member 1A (Higd1a), (10ug)



  "NM_019814" in other vectors (6)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210020B17Rik; 7420700H20Rik; AI303276; AW049839; Hig1; HIMP1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021594
GCCAGAAACCGGCAGGACTGGAAGGGACCCCGCGTCTCGGAAGACTCTTCAAGAAATCACAATGTCAACC AACACAGACCTTTCTCTCTCTTCATACGATGAAGGTCAGGGGTCTAAGTTTATTCGGAAAGCTAAGGAGA CACCGTTTGTCCCCATTGGAATGGCGGGCTTTGCAGCGATTGTTGCCTATGGGTTGTACAAGCTGAAGAG CAGAGGAAATACAAAGATGTCCATTCACTTGATCCACATGCGTGTAGCAGCCCAGGGCTTTGTTGTGGGG GCCATGACTCTTGGTATGGGCTACTCCATGTATCAAGAATTCTGGGCCAACCCTAAGCCTAAGCCTTAGA AGAGCTGGTGGCATGGGAAGTGCTTGCTTTAGTTAGACGTCTCATATTGAGGTTACGTGTTTGTATCTAC AATAAATAACATGTGGGTTTAGACAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019814
Insert Size 288 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021594, AAH21594
RefSeq Size 469 bp
RefSeq ORF 288 bp
Locus ID 56295
UniProt ID Q9JLR9
Gene Summary Proposed subunit of cytochrome c oxidase (COX, complex IV), which is the terminal component of the mitochondrial respiratory chain that catalyzes the reduction of oxygen to water. May play a role in the assembly of respiratory supercomplexes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. All six variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...