Klk1b4 (NM_010915) Mouse Untagged Clone

CAT#: MC204072

Klk1b4 (untagged) - Mouse kallikrein 1-related pepidase b4 (Klk1b4), (10ug)



  "NM_010915" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms alpha-NGF; mGk-4; Ng; Ngfa
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC034518
CTCCTGGACACCTGTTACCATGTGGTTCCTGATCCTGTTCCTAGCCCTGTCCCTAGGAGGGATTGATGCT GCACCTCCTGTCCAGTCTCAAGTGGACTGTGAGAATTCCCAACCCTGGCATGTGGCTGTGTACCGCTTCA ACAAATATCAATGCGGGGGAGTCCTGTTGGACCGCAACTGGGTTCTCACAGCTGCCCACTGCTATAACGA CAAGTACCAGGTTTGGCTGGGCAAAAACAACTTTTTGGAGGATGAACCTTCTGACCAACACCGGCTTGTC AGCAAAGCCATCCCTCACCCTGACTTCAACATGAGCCTCCTGAATGAGCACACCCCACAACCTGAGGACG ACTACAGCAATGACCTGATGCTGCTCCGCCTCAGCAAGCCTGCTGACATCACAGATGTTGTGAAGCCCAT CACCCTGCCCACTGAGGAGCCCAAGCTGGGGAGCACATGCCTAGCCTCAGGCTGGGGCAGCACTACACCC ATCAAGTTCAAATATCCAGATGATCTCCAGTGTGTGAACCTCAAGCTCCTGCCTAATGAGGACTGTGACA AAGCACATGAAATGAAGGTGACAGATGCCATGCTGTGTGCAGGAGAGATGGATGGTGGCTCATACACTTG TGAGCATGACTCAGGAGGCCCACTGATCTGTGATGGTATTCTCCAAGGTATCACATCATGGGGCCCTGAA CCATGTGGTGAGCCCACTGAGCCAAGTGTCTACACCAAACTTATTAAGTTCAGCTCCTGGATAAGAGAAA CTATGGCGAATAACCCCTGAGTGTCACATTGTCCCCTTTTCTCAATAAAGCCCACCATGCAGCAAATGAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010915
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC034518, AAH34518
RefSeq Size 853 bp
RefSeq ORF 771 bp
Locus ID 18048
UniProt ID P00757
Gene Summary This gene encodes the alpha subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...