Selenof (NM_053102) Mouse Untagged Clone

CAT#: MC203889

Sep15 (untagged) - Mouse selenoprotein (Sep15), (Note, selenocysteine protein, internal stop codon, see summary), (10ug) BC019792



  "NM_053102" in other vectors (2)

CNY 1,936.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
SEP15 Rabbit monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Synonyms 9430015P09Rik; Sep; Sep15
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019792
GGCAGACCGCAGGGATGGCGGCAGGGCAGGGTGGGTGGCTGCGGCCCGCTCTGGGGCTGCGCTTGCTGCT GGCGACTGCGTTTCAAGCGGTGTCTGCTCTGGGGGCAGAGTTTGCGTCAGAGGCATGCAGAGAGTTGGGT TTCTCCAGCAACTTGCTCTGCAGCTCTTGCGATCTTCTTGGACAGTTTAATCTGCTCCCACTGGACCCTG TTTGCAGAGGGTGCTGTCAGGAAGAAGCACAATTTGAAACCAAAAAGCTGTATGCAGGAGCCATCCTTGA AGTCTGCGGATGAAAATTGGGGAGGTTGCCTCAAGTCCAAGCTTTTGTCAGAAGTGATAAACCCAAACTC TTCAGAGGTCTACAGATCAAGTATGTTCGAGGCTCAGACCCTGTACTAAAGCTTTTGGACGACAACGGGA ACATTGCTGAAGAACTAAGCATCCTCAAATGGAACACAGACAGTGTGGAAGAGTTCCTGAGCGAGAAGTT GGAACGCATATAAACATGCTTAGTAGTTTTTATACTAATCAAATGAATTATCACAGCACCTAGACAATAA CTTAGTTTTGCATGCTTACATTGGTCATCCTTTTTATGTACATCATTAATCTTCTGACAAGAAGCTGAAG TAGCACCACAGTCCATAATATATCAGGATCTGGCAAGCTTAAGGAACCCAGCTCTTAGAAATTTCTCTTC TTCTACACTTGTTGCTCTCACCAGTGAAACGCTTTGTAAGGAGGCATCTGGGTAATTATGCAAATAAGTT TGTGATAATTGCTCCAGTTCTACAAACAACAGAATTTTAAATAGAGGAAGTGGATAAAGGAGACACCTCC CTTGCTGTGTGCTCTTTGAAAGTAATTGACAGAAAACTACAAACACGTAGGATGCCCTGCGCCTCAGCAG CACCCACCCCAGAGCCTCTTGGCGTGCCCAGCTTTCTTTTCAGTACAAGTATTTGTAGTTTGTAATGAAT GTGCCACATACAGGTTTTGTAGCTTATTATTATGGAACAGACTGAAGATCTGCAGTACGAATGTAATACT TATAAAGGTTTGCATTAATGAGGATTACACAGAAAACCTTTGTTAAGGACTTGTGTAGATCTGATAATTG GCAAATTTTTATTTTAAAAGTATTCTTACAGAAGAGTTCCATTTAAGAATGTTCACTTATAGGACCAAAA TATAAATAAAAACTTTCAAATATGTTTGATTTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_053102
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019792, AAH19792
RefSeq Size 1238 bp
Locus ID 93684
UniProt ID Q9ERR7
Gene Summary The protein encoded by this gene belongs to the SEP15/selenoprotein M family. The exact function of this protein is not known; however, it has been found to associate with UDP-glucose:glycoprotein glucosyltransferase (UGTR), an endoplasmic reticulum(ER)-resident protein, which is involved in the quality control of protein folding. The association with UGTR retains this protein in the ER, where it may play a role in protein folding. Knockout studies in mice also suggest a role for this gene in cataract formation and colon carcinogenesis. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Nov 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...