Exosc4 (NM_175399) Mouse Untagged Clone
CAT#: MC203787
Exosc4 (untagged) - Mouse exosome component 4 (Exosc4), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110039I09Rik; 1500001N04Rik; Rrp41 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012277
TCCAGGTCGAGCTGTCGGAGGCGGAGCCAGGACTGTACATCATGGCCGGGCTGGAGCTCCTGTCCGATCA GGGTTACCGGATAGACGGTCGCCGCGCGGGGGAGCTGCGCAAGATCCAGGCGCGGATGGGCGTGTTTGCG CAGGCCGATGGCTCGGCTTACATCGAGCAGGGAAACACCAAGGCACTGGCGGTGGTCTACGGGCCTCACG AGATCCGGGGCTCCCGGTCTCGAGCCCTGCCCGACCGGGCTCTAGTGAACTGTCAGTACAGTTCAGCCAC CTTCAGCACAGGTGAGCGCAAGCGAAGGCCTCATGGAGACCGGAAGTCTTGTGAGATGGGGCTGCAGCTA CGACAGACCTTCGAGGCAGCCATCCTCACACAGCTGCACCCCCGCTCTCAGATCGACATCTACGTGCAGG TGCTGCAAGCAGATGGTGGGACCTACGCAGCATGTGTGAATGCAGCCACGCTAGCAGTGATGGATGCTGG GATACCTATGCGGGACTTTGTATGCGCATGTTCAGCTGGCTTTGTGGATGGCACAGCACTAGCGGACCTC AGCCACGTGGAGGAAGCAGCTGGAGGGCCCCAGCTCGCCCTGGCCCTGCTGCCCGCCTCCGGCCAGATCG CACTGCTTGAGATGGACTCGAGGCTGCACGAAGACCACTTGGAGCAGGTGCTAGAGGCTGCTGCCCAGGC GGCCCGAGGTGTGCACACTCTGCTGGACCTTGTCGTCCGACAGCACGTGCAGGAGGCCTCTGTCTCACTG GGGGACTGAGTGGCAACCACCCGTTTCCAGAATAAAGGCCTGTTCTTCTCCCGAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_175399 |
Insert Size | 738 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC012277, AAH12277 |
RefSeq Size | 854 bp |
RefSeq ORF | 738 bp |
Locus ID | 109075 |
UniProt ID | Q921I9 |
Gene Summary | Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC4 binds to ARE-containing RNAs (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203072 | Exosc4 (tGFP-tagged) - Mouse exosome component 4 (Exosc4) |
CNY 2,850.00 |
|
MR203072 | Exosc4 (Myc-DDK-tagged) - Mouse exosome component 4 (Exosc4) |
CNY 2,400.00 |
|
MR203072L3 | Lenti ORF clone of Exosc4 (Myc-DDK-tagged) - Mouse exosome component 4 (Exosc4) |
CNY 4,750.00 |
|
MR203072L4 | Lenti ORF clone of Exosc4 (mGFP-tagged) - Mouse exosome component 4 (Exosc4) |
CNY 4,750.00 |