United States
Germany
Japan
United Kingdom
China
Arfrp1 (NM_029702) Mouse Untagged Clone
CAT＃: MC203697
Arfrp1 (untagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2, (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1500006I01Rik; AI480700 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC010713
CCCATGCGTCCGGCTCCGTCCTTCGCTCCTTGTTCCGTCAGGCACTGTGAGGGGTCAGCGTGAGGTCGGT GGGGTTAGGAACGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTCCTCCTCCAAGATCTGAGCAGGGTGCCA GAACAGGATGTACACGCTGCTTTCGGGATTGTACAAGTACATGTTCCAGAAGGATGAATACTGCATCCTG ATCCTGGGCCTGGACAATGCTGGGAAGACGACTTTCCTGGAACAGTCAAAAACACGCTTTAACAAGAACT ACAAGGGGATGAGTCTATCCAAAATCACCACTACCGTGGGTCTAAACATTGGCACTGTGGACGTGGGAAA GGCTCGTCTCATGTTTTGGGACTTAGGTGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTACTATGCA GAGTGCCATGGTGTCATCTATGTAATTGATTCCACTGATGAAGAAAGGCTGTCAGAATCAAAAGAGGCAT TTGAGAAGGTGGTTTCGAGTGAAGCACTGGACGGTGTTCCCATCCTGGTGTTGGCCAACAAGCAGGATGT GGAGACTTGCCTCTCCATTCCTGACATCAAGACTGCATTCAGTGACTGTACCTGTAAGATTGGCCGGCGA GATTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTTCGAGAGGGCATCGAATGGATGGTGA AGTGTGTCGTGCGGAATGTTCACCGGCCACCACGGCAGAGGGACATCACATAAGGACCTCCAACCTCAGT CTTGGACTGTTCGTCTCCTAGTGTTGGAAGAGTATTCTCTGCTGGCTTCTATCCTACTGACACTGGGGGT TGAGCTGCCTTTGTCTGTTCATTCTTTTATTTGCTTTATGTTTTCTCTAAGACAAACTTTTCTCTGTGTC TGGAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_029702 |
| Insert Size | 606 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC010713, AAH10713 |
| RefSeq Size | 934 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 76688 |
| UniProt ID | Q8BXL7 |
| Gene Summary | The gene encodes a membrane-associated GTPase that is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) genes. It plays an essential role in Golgi function controlling recruitment of GRIP domain proteins and ARL1 to the trans-Golgi and trans-Golgi to plasma membrane trafficking of cell surface proteins such as E-cadherin. Deletion of this gene in mice leads to embryonic lethality during early gastrulation, which is at least partly caused by the disruption of E-cadherin trafficking to the cell surface and therefore lack of sufficient cell-cell adhesion in the embryo. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222074 | Arfrp1 (tGFP-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1) transcript variant 2, (10ug) |
CNY 2,190.00 |
|
| MR222074 | Arfrp1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 |
CNY 2,000.00 |
|
| MR222074L3 | Lenti ORF clone of Arfrp1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 |
CNY 3,900.00 |
|
| MR222074L4 | Lenti ORF clone of Arfrp1 (mGFP-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 |
CNY 3,900.00 |
