Agtrap (NM_009642) Mouse Untagged Clone
CAT#: MC203284
Agtrap (untagged) - Mouse angiotensin II, type I receptor-associated protein (Agtrap), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 3300002E14Rik; AT1R; Atrap; D4Wsu124e |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC057196
GCTCAGGTGCCCTCCGCCGGGTCGGGATGGAGCTGCCTGCCGTGAACTTGAAGGTTATTCTCCTGGTTCA CTGGCTGTTGACAACCTGGGGCTGCTTGGTGTTCTCAAGCTCCTATGCTTGGGGCAACTTCACTATCCTG GCCCTGGGTGTGTGGGCTGTGGCCCAGCGGGACTCTATAGATGCCATAGGCATGTTTCTTGGTGGCTTGG TTGCCACCATCTTCCTGGACATTATCTACATTAGCATCTTCTACTCGAGTGTTGCCACTGGGGACACTGG CCGCTTCGGCGCCGGCATGGCCATCCTCAGCTTGCTGCTGAAGCCCTTCTCTTGCTGCCTCGTCTACCAC ATGCACCGTGAACGAGGGGGTGAGCTCCCCCTCCGCCCCGATTTCTTCGGACCCTCTCAGGAGCACAGTG CCTACCAGACAATTGACTCATCATCAGACGCTGCTGCAGACCCCTTTGCAAGCCTGGAGAACAAGGGCCA AGCTGCCCCCCGGGGGTACTGAAGCTGTCCCTGGTCGTCCTGGTCCCCAGCAGGATTCTTGTTCAAACCT TCTTTACCTGGACCTACAGTGGGGCATCCGCCATTCCCTATCACAGAGGTGGCCTGAGTCATGTGCCCTT GGAGGTCAAGAGCCTCTAGCTTCTCAGCGGAGAAGAGCCCAGTCCTAATTCTCCAGGCTACCCCTCCCTT CAAGACACCTGTTAACCCCTGAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009642 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC057196, AAH57196 |
RefSeq Size | 738 bp |
RefSeq ORF | 486 bp |
Locus ID | 11610 |
UniProt ID | Q9WVK0 |
Gene Summary | Appears to be a negative regulator of type-1 angiotensin II receptor-mediated signaling by regulating receptor internalisation as well as mechanism of receptor desensitization such as phosphorylation. Induces also a decrease in angiotensin II-stimulated transcriptional activity. May play a role of negative regulator in cardiomyocyte hypertrophy induced by angiotensin II through an inhibition of p38 mitogen-activated protein kinase pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201251 | Agtrap (tGFP-tagged) - Mouse angiotensin II, type I receptor-associated protein (Agtrap) |
CNY 2,850.00 |
|
MR201251 | Agtrap (Myc-DDK-tagged) - Mouse angiotensin II, type I receptor-associated protein (Agtrap) |
CNY 1,200.00 |
|
MR201251L3 | Lenti ORF clone of Agtrap (Myc-DDK-tagged) - Mouse angiotensin II, type I receptor-associated protein (Agtrap) |
CNY 4,750.00 |
|
MR201251L4 | Lenti ORF clone of Agtrap (mGFP-tagged) - Mouse angiotensin II, type I receptor-associated protein (Agtrap) |
CNY 4,750.00 |