Txnl4a (NM_025299) Mouse Untagged Clone

CAT#: MC203182

Txnl4a (untagged) - Mouse thioredoxin-like 4A (Txnl4a), transcript variant 1, (10ug)



  "NM_025299" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D18Wsu98e; Dim1; ENSMUSG00000057130; Txnl4; U5-15kD; U5-15kDa
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031634
GGCGGGTGGAGGACGCGGTGGTCGGGCCGCGTGGGCTCACACGAGGTAGCTCGCGGCGTCCGGCCGCGCT TGCGCGCTCAAGATGTCGTACATGCTTCCGCATCTGCACAATGGCTGGCAGGTAGACCAGGCCATCCTTT CGGAGGAGGACCGCGTGGTCGTCATTCGTTTCGGACACGACTGGGACCCCACTTGCATGAAGATGGACGA GGTTCTGTACAGCATCGCCGAAAAGGTTAAAAATTTTGCAGTTATTTATCTTGTGGATATTACAGAAGTG CCTGACTTCAACAAGATGTACGAGCTGTATGACCCCTGCACTGTCATGTTCTTCTTCAGAAACAAACATA TCATGATTGATTTGGGCACTGGCAACAACAACAAGATCAACTGGGCCATGGAAGACAAGCAAGAAATGGT TGACATCATAGAGACCGTGTACCGTGGCGCCCGCAAAGGCCGGGGTCTGGTGGTGTCTCCCAAGGACTAT TCTACCAAGTACAGATACTGAGCCCTGCCCTCAGGCTGTGCAAAGGACACTGAGAGCCTCTTCCACATAG AAATCCTCTGCTCTCGTAGCCTCTGGAAAGGCCCTGCAGCCCGACATTGCTGTAGAGCTGGAGGATCCGT GAGATGAGGGTTACAGAGCCTTAGCTAGCTGAAGCAAATAAACATGGCGAGGGAGCAGTGGGAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025299
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC031634, AAH31634
RefSeq Size 784 bp
RefSeq ORF 429 bp
Locus ID 27366
UniProt ID P83877
Gene Summary Plays role in pre-mRNA splicing as component of the U5 snRNP and U4/U6-U5 tri-snRNP complexes that are involved in spliceosome assembly, and as component of the precatalytic spliceosome (spliceosome B complex).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...