Rpl11 (NM_025919) Mouse Untagged Clone
CAT#: MC203164
Rpl11 (untagged) - Mouse ribosomal protein L11 (Rpl11), (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010203J19Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025077
CTCCACCATGGCGCAAGATCAAGGGGAAAAGGAGAACCCCATGCGGGAACTGCGCATCCGCAAGCTCTGC CTCAATATCTGCGTCGGGGAGAGCGGAGACAGACTGACCCGGGCAGCCAAGGTGTTGGAGCAGCTCACAG GCCAGACCCCGGTGTTCTCCAAAGCTAGATACACTGTCAGGTCCTTTGGCATCCGGAGAAATGAGAAGAT TGCTGTTCACTGCACAGTCCGCGGAGCCAAGGCAGAGGAAATTCTGGAGAAAGGCCTGAAGGTGCGGGAG TATGAGTTGCGGAAAAATAACTTCTCGGATACTGGAAACTTTGGTTTTGGAATTCAAGAACACATTGACC TGGGCATCAAATACGACCCAAGCATTGGGATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGG GTTCAGCATCGCAGACAAGAAGCGCAGAACAGGCTGCATTGGGGCCAAACACAGAATCAGCAAGGAGGAG GCCATGCGCTGGTTCCAGCAGAAGTACGATGGAATCATCCTTCCTGGAAAATAAACTTGATCCAAAAAGC TAATAAAATTTTCTCAGAAATGCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025919 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC025077, AAH25077 |
RefSeq Size | 598 bp |
RefSeq ORF | 537 bp |
Locus ID | 67025 |
UniProt ID | Q9CXW4 |
Gene Summary | Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. As part of the 5S RNP/5S ribonucleoprotein particle it is an essential component of the LSU, required for its formation and the maturation of rRNAs. It also couples ribosome biogenesis to p53/TP53 activation. As part of the 5S RNP it accumulates in the nucleoplasm and inhibits MDM2, when ribosome biogenesis is perturbed, mediating the stabilization and the activation of TP53 (PubMed:21804542). Promotes nucleolar location of PML (PubMed:15195100).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201576 | Rpl11 (tGFP-tagged) - Mouse ribosomal protein L11 (Rpl11) |
CNY 2,850.00 |
|
MR201576 | Rpl11 (Myc-DDK-tagged) - Mouse ribosomal protein L11 (Rpl11) |
CNY 2,400.00 |
|
MR201576L3 | Lenti ORF clone of Rpl11 (Myc-DDK-tagged) - Mouse ribosomal protein L11 (Rpl11) |
CNY 4,750.00 |
|
MR201576L4 | Lenti ORF clone of Rpl11 (mGFP-tagged) - Mouse ribosomal protein L11 (Rpl11) |
CNY 4,750.00 |