Gemin6 (NM_026053) Mouse Untagged Clone

CAT#: MC203161

Gemin6 (untagged) - Mouse gem (nuclear organelle) associated protein 6 (Gemin6), (10ug)



  "NM_026053" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610019B15Rik; 2810470M17Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC025157
GAAATATAGCCAGGGTCTCTGCGGCGTTTCCCTGAGTCGTGCAGAGTTCTGGGTATGGCGGCCTCTGGAC AGGACCTGGTGTTGGAGCTCTAGAGCTTCGCTAACGGGTCCTCAGCGCTTTACGAGAAAATTGGCGCAAA GCCCGTGGAGAGTCATCTAGAAAGAATCTGGGCAACTGGTAACCATGAGCGAATGGATGAAGAAAAGCCC CTTAGAATGGGAAGATTACGTTTATAAAGAAGTGAGAGTGATAGCCTGTGAGAAGGAGTATAAAGGATGG CTTCTAACCACAGATCCAGTCTCTGCCAACATTGTCCTCGTAAACTTCCTTGAAGATGGCAGATTGTCTG TGACTGGAATCATGGGCCACTCTGTGCAGACTGTGGAAACCATAAGTGAAGGGGACCACAGAGTACGCGA GAAGCTGATGCATGTGTTTGCATCTGGAGACTGTAAAGGATACAGCCCCGAGGATCTGGAAGAGAAGAGG ACCAGCCTCAAGAAATGGCTGGAGAAGAACCACATTCCTGTCACCGAGCAGGGGGATGCACAAAGGACTC TCTGTGTGGCTGGGGTTCTGACTATAGACCCACCATACGCTCCAGAAAACTGCAGCAGCTCCAATGAGAT CATTCTGTCCCGAATTCAGGATCTTATTCAAGGACATCTTTCAGCTTCCCAGTGAGAGGCCAAGCACTGT GAACATGCTGGCTTCACCGTTTGGTTTTGTATTCAATTCTTCCAATGTAAGTTGATTATATTACAAGACA TCAGAAGCACATGAGGGTTATAGGTGTGTGTGCGTATTTTAAGGTTTTGTTCAGATCAGATCAGATGAGT AGATCATGAGTGCTGGGTTCCTTAGGAATTGAAGGTACAAGAGCAGTGCCTCTGTGAAAATAACACAGGG AAGTCAGATTTGAAAGGAGCTTTTCTTGTGTGTGATTTAAGATAAATTGCCCTTTTTTGTGAGACAAGAA TACATTTTGAATAGGTATAACAATGAAATAAATTTATAAATTTCAATATAAGATATTAAAGTAAAAAAAA AAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026053
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC025157, AAH25157
RefSeq Size 1057 bp
RefSeq ORF 501 bp
Locus ID 67242
UniProt ID Q9CX53
Gene Summary The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...