United States
Germany
Japan
United Kingdom
China
Dbi (NM_007830) Mouse Untagged Clone
CAT＃: MC203145
Dbi (untagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACBD1; Acbp; endozepine; EP |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC028874
GAGCTTGCTCCCGCGCATTCGGCATCCGTATCACCTCACCAGTATGTCTCAGGCTGAATTTGACAAAGCC GCTGAGGAGGTGAAGCGCCTCAAGACTCAGCCAACTGATGAAGAGATGCTGTTCATCTACAGTCACTTCA AACAAGCTACCGTGGGCGATGTAAATACAGATCGGCCGGGGCTCTTGGACCTCAAGGGCAAAGCCAAGTG GGACTCGTGGAACAAGCTGAAAGGGACTTCCAAGGAAAGTGCCATGAAGACCTATGTGGAAAAGGTAGAC GAGCTAAAGAAGAAATACGGAATATAAATCACCAGATTTGGTGGCCAGCCACACGTGTGACCTGTGAGGA CATAATGCCTTGGTTTTTTCTAATGTAGATGATATGGCTGTGATACATTAGGGCCAGCGTTAACCTCTGC TCCTCCTCCCTCTGTAGTTTTTACCTACAATCAATTAAAAGTACATTTGTTACTCTGAAAAAAAAAAAAA AAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007830 |
| Insert Size | 264 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028874, AAH28874 |
| RefSeq Size | 500 bp |
| RefSeq ORF | 264 bp |
| Locus ID | 13167 |
| UniProt ID | P31786 |
| Gene Summary | Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200197 | Dbi (Myc-DDK-tagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2 |
CNY 1,200.00 |
|
| MR200197L3 | Lenti ORF clone of Dbi (Myc-DDK-tagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2 |
CNY 4,750.00 |
|
| MR200197L4 | Lenti ORF clone of Dbi (mGFP-tagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2 |
CNY 4,750.00 |
