United States
Germany
Japan
United Kingdom
China
Ttr (NM_013697) Mouse Untagged Clone
CAT＃: MC203140
Ttr (untagged) - Mouse transthyretin (Ttr), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AA408768; AI787086; D17860; prea; prealbumin |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024702
GTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGC AGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAAGAGAAGCCGTCACACAGA TCCACAAGCTCCTGACAGGATGGCTTCCCTTCGACTCTTCCTCCTTTGCCTCGCTGGACTGGTATTTGTG TCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCC GAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTT TGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGA GTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCG CGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGCCCTGCTCAGCCCATA CTCCTACAGCACCACGGCTGTCGTCAGCAACCCCCAGAATTGAGAGACTCAGCCCAGGAGGACCAGGATC TTGCCAAAGCAGTAGCATCCCATTTGTACCAAAACAGGGTTTTTGTTTTATAAACCGTGTTAGCAGCTCA GGAAGATGCCGGGAAGCATTTTTATTAAACCCCCTGTTATTTCTTTCAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_013697 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC024702, AAH24702 |
| RefSeq Size | 809 bp |
| RefSeq ORF | 800 bp |
| Locus ID | 22139 |
| UniProt ID | P07309 |
| Gene Summary | This gene encodes a carrier protein responsible for the transport of thyroid hormones and retinol. The protein consists of a tetramer of identical subunits. Due to increased stability of the tetramer form of this encoded protein in mouse, compared to the human protein, this gene product has a reduced tendency to form amyloid fibrils. In humans, this protein binds beta-amyloid preventing its aggregation and providing a neuroprotective role in Alzheimer's disease. [provided by RefSeq, Mar 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200992 | Ttr (tGFP-tagged) - Mouse transthyretin (Ttr) |
CNY 2,800.00 |
|
| MR200992 | Ttr (Myc-DDK-tagged) - Mouse transthyretin (Ttr) |
CNY 1,200.00 |
|
| MR200992L3 | Lenti ORF clone of Ttr (Myc-DDK-tagged) - Mouse transthyretin (Ttr) |
CNY 4,750.00 |
|
| MR200992L4 | Lenti ORF clone of Ttr (mGFP-tagged) - Mouse transthyretin (Ttr) |
CNY 4,750.00 |
