Mgp (NM_008597) Mouse Untagged Clone

CAT#: MC202781

Mgp (untagged) - Mouse matrix Gla protein (Mgp), (10ug)



  "NM_008597" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Mg; Mglap
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC079478 sequence for NM_008597
CTCCCCTCTGCTGCTGCTGCTGCTGCGCCAGACACAGAGGCAGACTCACAGGACACCCGAGACACCATGA AGAGCCTGCTCCCTCTGGCCATCCTGGCTGCGCTGGCCGTGGCAACCCTGTGCTACGAATCTCACGAAAG CATGGAGTCCTATGAAATCAGTCCCTTCATCAACAGGAGAAATGCCAACACCTTTATGTCCCCTCAGCAG AGGTGGCGAGCTAAAGCCCAAAAGAGAGTCCAGGAACGCAACAAGCCTGCCTACGAGATCAACAGAGAGG CCTGCGATGACTACAAGCTGTGTGAGCGCTACGCCATGGTCTACGGCTACAACGCTGCCTACAACCGCTA CTTCAGGCAGCGCCGAGGAGCCAGATATTAGCGCGAAGAAACAGTCATTTGGTTGTGGAGTTTCGTTTTA TATCTCCTGCAGTAGCATTACTGAAGTATACAGACACGCATGCGTTGCTTGCTCCTTACATGATCTCCTA GCTGGCTGGCCCACTCCTTCCTTCCGCGGGTTGAAAGTAATGAAAGAGCAGTATTAAGAAGTGTGTTTAT ATATAATAAAATTCTGGTTTGATACGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008597
Insert Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC079478, AAH79478
RefSeq Size 617 bp
RefSeq ORF 315 bp
Locus ID 17313
UniProt ID P19788
Gene Summary This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. This protein also inhibits angiogenesis. Mice lacking a functional copy of this gene exhibit impaired differentiation of endothelial cells, reduced stature, and calcification and rupture of the vasculature leading to premature death. [provided by RefSeq, Sep 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...