Ifitm2 (NM_030694) Mouse Untagged Clone
CAT#: MC202748
Ifitm2 (untagged) - Mouse interferon induced transmembrane protein 2 (Ifitm2), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | DSPA2c; fragilis3; Ifitm3l; mil-3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC084679 sequence for NM_030694
GCAGCAGCCATCCTCCAGACGGGGCGATTGTTCCAGAGTCAGTACCATGAGCCACAATTCTCAAGCCTTC TTGTCCACCAATGCCGGGCTTCCTCCAAGCTATGAGACAATCAAAGAGGAGTACGGGGTGACTGAGCTGG GGGAACCCAGCAACTCAGCTGTTGTGAGGACCACCGTGATCAACATGCCCAGAGAGGTGTCGGTGCCTGA CCATGTGGTCTGGTCCCTGTTCAATACACTCTTCTTCAACGCCTGCTGCCTGGGCTTCGTTGCCTATGCC TACTCTGTGAAGTCTAGGGACAGGAAGATGGTGGGCGATGTGGTTGGAGCCCAGGCCTACGCCTCCACTG CCAAGTGCCTGAATATCAGCTCCCTGATCTTCAGCATCCTTATGGTCATTATCTGCATCATTATTTTCTC TACCACCTCTGTGGTAGTCTTTCAGTCTTTTGCACAAAGAACACCCCATTCTGGATTCTAGCTGCCCTGT GCTCCACGGTCCACATCTGCCCCGCCCCTGCCCCGCCCCCAGGCTCAAGCCTCGACCCTTTACCCTACGC GTATGCAAATGTTACCTTCACCTATCTGTCCACAGTGGATTCAATAAAGTGCACGGGGTGGCAACTCTGA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_030694 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC084679, AAH84679 |
RefSeq Size | 719 bp |
RefSeq ORF | 435 bp |
Locus ID | 80876 |
UniProt ID | Q99J93 |
Gene Summary | IFN-induced antiviral protein which inhibits the entry of viruses to the host cell cytoplasm, permitting endocytosis, but preventing subsequent viral fusion and release of viral contents into the cytosol. Active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV) and Ebola virus (EBOV), Dengue virus (DNV) and West Nile virus (WNV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry and SARS-CoV S protein-mediated viral entry. Induces cell cycle arrest and mediates apoptosis by caspase activation and in p53-independent manner.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200956 | Ifitm2 (tGFP-tagged) - Mouse interferon induced transmembrane protein 2 (Ifitm2) |
CNY 2,850.00 |
|
MR200956 | Ifitm2 (Myc-DDK-tagged) - Mouse interferon induced transmembrane protein 2 (Ifitm2) |
CNY 1,200.00 |
|
MR200956L3 | Lenti ORF clone of Ifitm2 (Myc-DDK-tagged) - Mouse interferon induced transmembrane protein 2 (Ifitm2) |
CNY 4,750.00 |
|
MR200956L4 | Lenti ORF clone of Ifitm2 (mGFP-tagged) - Mouse interferon induced transmembrane protein 2 (Ifitm2) |
CNY 4,750.00 |