Atp5g2 (NM_026468) Mouse Untagged Clone

CAT#: MC202482

Atp5g2 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_026468" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1810041M08Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC081437 sequence for NM_026468
TCTGCCCTGGGAGCAGCCCTCCTGCCTCGGCCCCTCACCCCTGAAAATGTACGCCTGCTCCAAGTTCGTC TCTACCCGCTCCCTGATCAGGAGCACCTCTCTCAGGAGCACCTCTCAGCTGCTGAGTCGTCCGCTGTCTG CAGTGGAGTTGAAGCGACCACAGATGCCAACAGATGAGAGCCTCAGCAGCTTGGCGGTCCGGCGGCCTCT GACTTCACTTATCCCTAGCCGCAGTTTCCAAACCAGCGCCATTTCAAGGGACATCGACACAGCTGCCAAG TTCATTGGAGCTGGGGCTGCGACAGTTGGGGTGGCTGGCTCTGGGGCAGGGATTGGGACTGTTTTTGGGA GTCTCATCATTGGCTATGCCAGGAACCCTTCTCTGAAGCAACAACTCTTCTCCTACGCGATTCTGGGCTT TGCCCTCTCAGAGGCCATGGGGCTCTTTTGCCTAATGGTGGCCTTTCTCATCCTCTTCGCCATGTGAAGC AGCTGTCTCCACTTCCACCTCCCATGGTTCTTTCGTGTCTCGTCTGCCCTGTATGTTCCTTTTCCTGTAA CTCCCCAAGAAGTCTGGGGAAAGTGCTTGGCTCAGGGTTTGACAGAGAGAAGACAAATAAATACTGTATT AATAAGAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_026468
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC081437, AAH81437
RefSeq Size 655 bp
RefSeq ORF 441 bp
Locus ID 67942
UniProt ID P56383
Gene Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. A homomeric c-ring of probably 10 subunits is part of the complex rotary element.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...