Sec61b (NM_024171) Mouse Untagged Clone
CAT#: MC202471
Sec61b (untagged) - Mouse Sec61 beta subunit (Sec61b), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1190006C12Rik; AI326121; AW122942 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC081445 sequence for NM_024171
GGCAACTTCACGACTTCCCTCTTCCTGCCTCCTGTGCCCACCGTTCTTAGGCATCAGCATGCCGGGTCCA ACGCCCAGTGGCACCAACGTGGGCTCCTCTGGCCGCTCTCCCAGCAAAGCGGTGGCCGCACGGGCTGCGG GATCCACTGTTCGGCAGAGAAAAAATGCCAGCTGTGGGACCCGGAGCGCAGGCCGCACCACCTCTGCAGG GACTGGGGGGATGTGGCGATTCTACACGGAAGATTCCCCAGGGCTCAAAGTGGGCCCTGTCCCAGTGCTG GTGATGAGTCTTCTGTTCATCGCTGCTGTATTTATGCTGCACATTTGGGGCAAGTACACGCGATCATAGA TTGGGCTACATCCATCTGTCATCTGAAGAAGAAGAAGAAGGAAAAAAACCCAACATATCTTGGACCAAAA GTGTAGTGATTTTCTGTTCACGTGTATTATTTTACAGAGAATAAGAATTGACTTTGAGAAATCAGTTTTT TCTATGGCTAATAAACTTTGGAATTGCTTTAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_024171 |
Insert Size | 291 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC081445, AAH81445 |
RefSeq Size | 542 bp |
RefSeq ORF | 291 bp |
Locus ID | 66212 |
UniProt ID | Q9CQS8 |
Gene Summary | Component of SEC61 channel-forming translocon complex that mediates transport of signal peptide-containing precursor polypeptides across endoplasmic reticulum (ER) (By similarity). Required for PKD1/Polycystin-1 biogenesis (PubMed:28375157).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200268 | Sec61b (tGFP-tagged) - Mouse Sec61 beta subunit (Sec61b) |
CNY 2,850.00 |
|
MR200268 | Sec61b (Myc-DDK-tagged) - Mouse Sec61 beta subunit (Sec61b) |
CNY 1,200.00 |
|
MR200268L3 | Lenti ORF clone of Sec61b (Myc-DDK-tagged) - Mouse Sec61 beta subunit (Sec61b) |
CNY 4,750.00 |
|
MR200268L4 | Lenti ORF clone of Sec61b (mGFP-tagged) - Mouse Sec61 beta subunit (Sec61b) |
CNY 4,750.00 |