United States
Germany
Japan
United Kingdom
China
Arl2 (NM_019722) Mouse Untagged Clone
CAT＃: MC202393
Arl2 (untagged) - Mouse ADP-ribosylation factor-like 2 (Arl2), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2610009M23Rik; AI115441; AW553335 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC060259 sequence for NM_019722
AGCGGCCGGGAGGGGGCTACGGGATCATGGGGCTTCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCG AGAGCTGCGGCTGCTCATGCTTGGCTTGGACAACGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGA GAAGACGTGGACACCATCTCCCCGACACTGGGCTTCAACATCAAGACCCTGGAGCACCGCGGATTCAAGC TGAACATCTGGGATGTAGGTGGCCAGAAGTCTCTGCGCTCCTACTGGAGGAACTACTTTGAGAGCACGGA TGGCCTCATCTGGGTGGTGGACAGCGCCGACCGCCAGCGCATGCAGGACTGTCAGCGAGAGCTGCAGAGC CTACTGGTGGAGGAGCGCCTGGCTGGAGCAACCCTCCTCATCTTTGCCAATAAGCAGGACCTGCCTGGAG CACTGTCCTGTAATGCTATTCAGGAGGCCCTGGAGCTGGACTCCATCCGCAGCCACCACTGGCGCATCCA GGGCTGCAGTGCTGTCACAGGGGAAGACCTGCTGCCTGGCATCGACTGGCTCCTTGATGACATTTCCAGT CGTGTCTTTACTGCCGACTGAGCTTCTTCAGTGTCCCCAGGTCCCTGTCCTCATCAGACACCAGCCAGAG GGATGAGCACCAGCTGGCCAGACTAACACTCCCAACCCCACCATGACCTGCTGCTGCTATTACTGCCCAT TGCTGCTCCCCCGGGTGAGGGCTGTCACCCTGTCTCCCAAAGTGGCCTGCAGCTGCCATGCCAAAAGGAA AGGCTGGGCTGGGAGGGACTACCTGCTGCTGCCAGGGTCCTAGGTGTCGCCTCGCCTCGGTCCAGCAGTG AGAATAAAGCACTCTTCACCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | AscI-NotI |
| ACCN | NM_019722 |
| Insert Size | 555 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC060259, AAH60259 |
| RefSeq Size | 931 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 56327 |
| UniProt ID | Q9D0J4 |
| Gene Summary | Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). GTP-binding protein that does not act as an allosteric activator of the cholera toxin catalytic subunit. Regulates formation of new microtubules and centrosome integrity. Prevents the TBCD-induced microtubule destruction. Participates in association with TBCD, in the disassembly of the apical junction complexes. Antagonizes the effect of TBCD on epithelial cell detachment and tight and adherens junctions disassembly. Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. Component of a regulated secretory pathway involved in Ca(2+)-dependent release of acetylcholine. Required for normal progress through the cell cycle.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201694 | Arl2 (tGFP-tagged) - Mouse ADP-ribosylation factor-like 2 (Arl2) |
CNY 2,090.00 |
|
| MR201694 | Arl2 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 2 (Arl2) |
CNY 1,900.00 |
|
| MR201694L3 | Lenti ORF clone of Arl2 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 2 (Arl2) |
CNY 3,800.00 |
|
| MR201694L4 | Lenti ORF clone of Arl2 (mGFP-tagged) - Mouse ADP-ribosylation factor-like 2 (Arl2) |
CNY 3,800.00 |
