Nrtn (NM_008738) Mouse Untagged Clone

CAT#: MC202337

Nrtn (untagged) - Mouse neurturin (Nrtn), (10ug)



  "NM_008738" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against Nrtn (C-terminal)
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms NTN
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC057993 sequence for NM_008738
GCTTCGTCCGTGTGCCCCGCGCCCGGCGCTCCTCGCGTGGCCCCGCGTCCTGAGCGCGCTCCAGCCTCCC ACGCGCGCCACCCCGGGGTTCACTGAGCCCGGCGAGCCCGGGGAAGACAGAGAAAGAGAGGCCAGGGGGG GAACCCCATGGCCCGGCCCGTGTCCCGCACCCTGTGCGGTGGCCTCCTCCGGCACGGGGTCCCCGGGTCG CCTCCGGTCCCCGCGATCCGGATGGCGCACGCAGTGGCTGGGGCCGGGCCGGGCTCGGGTGGTCGGAGGA GTCACCACTGACCGGGTCATCTGGAGCCCGTGGCAGGCCGAGGCCCAGGATGAGGCGCTGGAAGGCAGCG GCCCTGGTGTCGCTCATCTGCAGCTCCCTGCTATCTGTCTGGATGTGCCAGGAGGGTCTGCTCTTGGGCC ACCGCCTGGGACCCGCGCTTGCCCCGCTACGACGCCCTCCACGCACCCTGGACGCCCGCATCGCCCGCCT GGCCCAGTATCGCGCTCTGCTCCAGGGCGCCCCCGACGCGGTGGAGCTTCGAGAACTTTCTCCCTGGGCT GCCCGCATCCCGGGACCGCGCCGTCGAGCGGGTCCCCGGCGTCGGCGGGCGCGGCCGGGGGCTCGGCCTT GTGGGCTGCGCGAGCTCGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACACGTCGGATGAGACCGTGCT GTTCCGCTACTGCGCAGGCGCGTGCGAGGCGGCCATCCGCATCTACGACCTGGGCCTTCGGCGCCTGCGC CAGCGGAGGCGCGTGCGCAGAGAGCGGGCGCGGGCGCACCCGTGTTGTCGCCCGACGGCCTATGAGGACG AGGTGTCCTTCCTGGACGTGCACAGCCGCTACCACACGCTGCAAGAGCTGTCGGCGCGGGAGTGCGCGTG CGTGTGATGCTACCTCACGCCCCCCGACCTGCGAAAGGGCCCTCCCTGCCGACCCTCGCTGAGAACTGAC TTCACATAAAGTGTGGGAACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008738
Insert Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC057993, AAH57993
RefSeq Size 1064 bp
RefSeq ORF 588 bp
Locus ID 18188
UniProt ID P97463
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. Homozygous knockout mice for this gene exhibit defects in the development of the retina and enteric nervous system, and reduced cholinergic innervation of the heart and lacrimal glands. [provided by RefSeq, Aug 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...