Etfb (NM_026695) Mouse Untagged Clone
CAT#: MC202302
Etfb (untagged) - Mouse electron transferring flavoprotein, beta polypeptide (Etfb), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610009I16Rik; 2810441H06Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC049237 sequence for NM_026695
GGAAGATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGGGTCATCGACTTCGCTGTGAAGATTCGGGT AAAGCCGGACAAGTCTGGAGTGGTCACTGATGGTGTGAAGCACTCCATGAACCCCTTCTGTGAGATTGCA GTGGAAGAGGCTGTGCGGCTAAAGGAGAAGAAACTGGTGAAGGAGATCATTGCCGTCAGCTGTGGCCCCT CACAGTGCCAGGAGACCATCCGAACTGCTCTGGCCATGGGTGCAGACAGAGGCATCCACGTGGAGATACC AGGGGCACAGGCAGAAAGCTTAGGCCCCCTGCAGGTGGCCCGGGTCCTGGCCAAGCTGGCTGAAAAGGAG AAAGTGGACCTTTTGTTCCTGGGCAAGCAGGCTATTGATGATGACTGTAACCAGACAGGTCAGATGACAG CTGGACTTCTGGACTGGCCGCAGGGTACATTCGCCTCTCAGGTGACACTGGAGGGGGACAAGGTAAAAGT GGAACGGGAAATTGACGGGGGTCTGGAGACCCTTCGCCTGAAGCTGCCCGCTGTGGTGACTGCTGACCTA AGGCTCAATGAGCCTCGCTATGCCACCCTGCCCAACATCATGAAAGCCAAGAAGAAGAAGATTGAAGTGG TCAAGGCTGGAGACCTGGGCGTGGACCTGACCTCCAAGGTCTCTGTGATCAGTGTGGAAGAGCCCCCTCA GCGCTCAGCAGGAGTCAAGGTGGAGACCACAGAAGACCTGGTGGCCAAGCTGAAGGAGGTGGGGCGGATC TGAGACCCTCCCTGATACTCTGCAATAAAACTGTGCCTTTCCAAGAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026695 |
Insert Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC049237, AAH49237 |
RefSeq Size | 835 bp |
RefSeq ORF | 768 bp |
Locus ID | 110826 |
UniProt ID | Q9DCW4 |
Gene Summary | Heterodimeric electron transfer flavoprotein that accepts electrons from several mitochondrial dehydrogenases, including acyl-CoA dehydrogenases, glutaryl-CoA and sarcosine dehydrogenase. It transfers the electrons to the main mitochondrial respiratory chain via ETF-ubiquinone oxidoreductase (By similarity). Required for normal mitochondrial fatty acid oxidation and normal amino acid metabolism (PubMed:25023281). ETFB binds an AMP molecule that probably has a purely structural role (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220480 | Etfb (tGFP-tagged) - Mouse electron transferring flavoprotein beta polypeptide (Etfb), (10ug) |
CNY 2,850.00 |
|
MR220480 | Etfb (Myc-DDK-tagged) - Mouse electron transferring flavoprotein, beta polypeptide (Etfb) |
CNY 2,400.00 |
|
MR220480L3 | Lenti ORF clone of Etfb (Myc-DDK-tagged) - Mouse electron transferring flavoprotein, beta polypeptide (Etfb) |
CNY 4,470.00 |
|
MR220480L4 | Lenti ORF clone of Etfb (mGFP-tagged) - Mouse electron transferring flavoprotein, beta polypeptide (Etfb) |
CNY 4,470.00 |