Aimp2 (NM_146165) Mouse Untagged Clone

CAT#: MC202134

Aimp2 (untagged) - Mouse aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 2, (10ug)



  "NM_146165" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA407136; AA407225; Aimp2(p38); Jtv1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024480 sequence for NM_146165
CCCACGCGTCCGGCCAGCAGCAGAGTCAGAAAGAAGGCGGCTGCTGTCTGAGGTGGCCTTGGGTGGCTTC TGAGCGTTCCTGTCCCTCGCCCGCTACCTTCCTTGGGTTCCCACCATGCCGATGTACCAGGAAACATCCG AGCCTTCTTTGCAAGCCCTTGAATCTCGCCAAGATGATATTTTAAAACGCTTGTATGAGTTGAAGGCAGC AGTCGATGGCCTTTCAAAGATGATTCACACCCCAGATGCAGACTTGGACGTAACCAACATCCTGCAAGCT GATGAGCCCACAACTTTAGCCACAAACACATTGGACTTGAATTCCGTGCTTGGAAAGGACTATGGGGCGC TGAAAGACATTGTGATCAACGCAAACCCAGCCTCCCCACCACTGTCCCTGCTTGTGCTGCACAGGCTGCT CTGTGAACGCTACAGGGTCCTGTCCACTGTGCACACACATTCGTCTGTCAAGAATGTGCCCGAGAATCTT GTCAAGTGCTTCGGGGAGCAGGCTAGGAAGCAGTCCCGCCACGAGTATCAGCTGGGCTTCACTCTGATTT GGAAGAATGTGCCCAAGACACAGATGAAGTTCAGTGTACAAACCATGTGCCCCATTGAAGGAGAAGGGAA CATCGCACGTTTCCTGTTCTCTCTGTTTGGCCAGAAGCATAATGCTGTCACCCTCACCCTCATCGATAGC TGGGTGGATATCGCCATGTTTCAGCTTCGAGAAGGCAGCAGTAAAGAAAAAGCGGCCGTGTTCCGCTCTA TGAACTCCGCTTTGGGGAGGAGCCCGTGGCTGGTTGGAAATGAGCTCACTGTGGCAGATGTGGTGCTGTG GTCTGTGCTCCAGCAGACTGGGGGCAGCAGTGGGGCAGCACCCACCAATGTGCAGCGGTGGCTTAAGTCC TGTGAAAACCTGGCCCCCTTCAGCACTGCCCTTCAGCTCCTTAAGTGAATTCGAGCAGCTTGTCTTGCAG GGTTCAACAGAAGAATGGTACGGCTTCCAGTCTGTTGTCAGAAAGGGACTTGTCCAATAAAGTACCATAT CATCTAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_146165
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC024480, AAH24480
RefSeq Size 1072 bp
RefSeq ORF 843 bp
Locus ID 231872
Gene Summary Required for assembly and stability of the aminoacyl-tRNA synthase complex (PubMed:12060739). Mediates ubiquitination and degradation of FUBP1, a transcriptional activator of MYC, leading to MYC down-regulation which is required for aveolar type II cell differentiation (PubMed:12819782). Blocks MDM2-mediated ubiquitination and degradation of p53/TP53 (PubMed:18695251). Functions as a proapoptotic factor (PubMed:16135753).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment near the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...