United States
Germany
Japan
United Kingdom
China
Guca2b (NM_008191) Mouse Untagged Clone
CAT＃: MC202104
Guca2b (untagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AV066530; Gca; Gcap2; Ugn; urog |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024373 sequence for NM_008191
CCCACGCGTCCGCCCACGCGTCCGGGAACCCAGAGGTGTGAGCTTGGAAGCGAGGCCATGTCAAGAAGCC AACTGTGGGCTGCCGTCGTCCTGCTGCTGCTCCTGCAGAGTGCACAGGGTGTCTACATCAAGTACCATGG CTTCCAAGTCCAGCTGGAATCAGTGAAGAAGCTGAATGAGTTGGAGGAGAAGGAGATGTCCAATCCCCAG CCGCGGAGAAGTGGCCTCCTCCCTGCTGTGTGCCATAACCCAGCCTTGCCCTTGGACCTCCAGCCTGTTT GTGCCTCCCAGGAAGCTGCCAGCACCTTCAAGGCCTTGAGGACCATCGCCACCGACGAATGTGAACTGTG TATAAATGTTGCCTGTACAGGCTGCTGATGAAATGACTCTGGGTCTTAAGACCACTCCGGACACTTTCCC CACAGCCCAACCTGTCCATACTTAGGCACCATTGAAGTAATCGCCATCCTCCCAGCATAAATGGATCCTT AGCAAGGCAATATGGATGCAGAGTTGCCATATTTGGCCCCCAGGCAGCTGCACCTGAATAAAAAATGCTA CCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008191 |
| Insert Size | 321 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024373, AAH24373 |
| RefSeq Size | 605 bp |
| RefSeq ORF | 321 bp |
| Locus ID | 14916 |
| UniProt ID | O09051 |
| Gene Summary | This gene encodes a member of the guanylin family and preproprotein that is proteolytically processed to generate a mature protein product. The mature protein product, known as uroguanylin, is an endogenous ligand for the guanylate cyclase-C receptor and may regulate salt and water homeostasis in the intestine and kidneys. Homozygous knockout mice for this gene exhibit impaired sodium chloride excretion and elevated arterial pressure. This gene is present in a gene cluster with a related guanylin family member on chromosome 4. [provided by RefSeq, Sep 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200368 | Guca2b (tGFP-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
CNY 2,850.00 |
|
| MR200368 | Guca2b (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
CNY 1,200.00 |
|
| MR200368L3 | Lenti ORF clone of Guca2b (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
CNY 4,750.00 |
|
| MR200368L4 | Lenti ORF clone of Guca2b (mGFP-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
CNY 4,750.00 |
