United States
Germany
Japan
United Kingdom
China
Bloc1s1 (NM_015740) Mouse Untagged Clone
CAT＃: MC201942
Bloc1s1 (untagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 1 (Bloc1s1), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI839753; BLOS1; Gcn5l1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC034662 sequence for NM_015740
GTCCGCCGTGCCCACACCCAGCCAGACTCGACCATGCTGTCCCGCCTGCTCAAAGAACACCAAGCCAAGC AGAACGAACGCAAGGAGCTGCAGGAGAAGAGGAGGAGAGAAGCTATCGCTGCAGCGACCTGCCTGACCGA AGCGTTGGTGGATCACCTCAACGTGGGTGTGGCCCAGGCCTACATGAACCAGAGAAAGCTGGACCATGAG GTGAAGACTCTACAGGTCCAGGCTGCCCAGTTTGCCAAGCAGACAGGCCAGTGGATTGGAATGGTGGAGA ACTTCAACCAGGCACTTAAGGAAATTGGGGATGTGGAGAACTGGGCTAGGAGCATCGAGCTGGACATGCG CACCATTGCCACTGCGCTGGAATACGTCTACAAAGGGCAGCTGCAGTCTGCACCATCCTAGACTAAAACC CACCCCTCTTACTTCACCCTCCTGGACAGGAGGGAAACTGGTGAGCCACGAATAAAAACACAAGCTTCCA TTCTAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_015740 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC034662, AAH34662 |
| RefSeq Size | 509 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 14533 |
| UniProt ID | O55102 |
| Gene Summary | Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes. In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals. The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension (PubMed:16760431, PubMed:19546860, PubMed:21998198). As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. The BORC complex is most probably associated with the cytosolic face of lysosomes, may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200647 | Bloc1s1 (tGFP-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 1 (Bloc1s1) |
CNY 2,850.00 |
|
| MR200647 | Bloc1s1 (Myc-DDK-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 1 (Bloc1s1) |
CNY 1,200.00 |
|
| MR200647L3 | Lenti ORF clone of Bloc1s1 (Myc-DDK-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 1 (Bloc1s1) |
CNY 4,750.00 |
|
| MR200647L4 | Lenti ORF clone of Bloc1s1 (mGFP-tagged) - Mouse biogenesis of lysosome-related organelles complex-1, subunit 1 (Bloc1s1) |
CNY 4,750.00 |
其它Bloc1s1产品
