United States
Germany
Japan
United Kingdom
China
Rnaseh2c (NM_026616) Mouse Untagged Clone
CAT＃: MC201846
Rnaseh2c (untagged) - Mouse ribonuclease H2, subunit C (Rnaseh2c), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1500026D16Rik; AYP1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024333 sequence for NM_026616
CTTCTGAGATGAAGAACCCGGAGGAAGCGGCAGAAGGGAAACAGCGTATTCACCTGCGCCCTGGCTCGCT GCGTGGTGCCGCACCGGCTAAGCTGCACCTCCTGCCCTGCGACGTTCTAGTCAGCCGGCCGGCCCCGGTA GATCGCTTCTTCACGCCCGCCGTCCGCCACGATGCAGACGGGCTACAGGCGTCGTTTCGCGGTCGCGGCC TGCGGGGCGAGGAGGTAGCTGTGCCGCCAGGGTTTGCGGGATTCGTGATGGTGACGGAGGAGAAGGGAGA GGGGTTGATAGGGAAACTGAACTTCTCCGGGGACGCGGAGGACAAAGCGGACGAGGCGCAGGAGCCGCTG GAGCGGGACTTCGACCGCCTTATCGGGGCCACCGGCAGCTTCAGCCATTTCACCTTGTGGGGTCTGGAAA CGGTCCCGGGTCCAGATGCCAAAGTGCATAGGGCCCTAGGTTGGCCCAGCCTCGCAGCAGCGATTCACGC CCAGGTCCCTGAGGACTGAGAACCAGATCATGAGAATGACAGTCACAGATCCCTTCTCACCACTTGGAGC GACTGTTTCTATCCCAATAAATGAGATCTTCACAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026616 |
| Insert Size | 501 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024333, AAH24333 |
| RefSeq Size | 608 bp |
| RefSeq ORF | 501 bp |
| Locus ID | 68209 |
| UniProt ID | Q9CQ18 |
| Gene Summary | Non catalytic subunit of RNase H2, an endonuclease that specifically degrades the RNA of RNA:DNA hybrids. Participates in DNA replication, possibly by mediating the removal of lagging-strand Okazaki fragment RNA primers during DNA replication. Mediates the excision of single ribonucleotides from DNA:RNA duplexes.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201353 | Rnaseh2c (tGFP-tagged) - Mouse ribonuclease H2, subunit C (Rnaseh2c) |
CNY 2,850.00 |
|
| MR201353 | Rnaseh2c (Myc-DDK-tagged) - Mouse ribonuclease H2, subunit C (Rnaseh2c) |
CNY 2,400.00 |
|
| MR201353L3 | Lenti ORF clone of Rnaseh2c (Myc-DDK-tagged) - Mouse ribonuclease H2, subunit C (Rnaseh2c) |
CNY 4,750.00 |
|
| MR201353L4 | Lenti ORF clone of Rnaseh2c (mGFP-tagged) - Mouse ribonuclease H2, subunit C (Rnaseh2c) |
CNY 4,750.00 |
其它Rnaseh2c产品
