Mrps34 (NM_023260) Mouse Untagged Clone
CAT#: MC201793
Mrps34 (untagged) - Mouse mitochondrial ribosomal protein S34 (Mrps34), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610007F04Rik; 5330430D13Rik; AV001970; Tce2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024336 sequence for NM_023260
CACTGACATGGCGCGGAAGAAAGTAAGACCCCGGCTGATCGCTGAGCTGGCTCGCCGCGTGCGCGCCTTG CGCGAGCAGCGGAACCAGCCGCGAGATTCTCAGCTCTACGCCCTAGACTACGAGACGCTGACCCGGCCGC ACTCCGGTCGCCGGCTGCCGGTACGCGCCTGGGCCGACGTGCGTCGCGAGAGCCGCCTCCTACAGCTGCT CGCCCGCCTCCCCTTGTTCGGCCTGGGCCGTCTGGTTACCCGCAAGTCCTGGCTGTGGCAGCACGACGAG CCATGCTACTGGCGCCTCACGCGTGTGAGGCCCGACTACACGGCGCAGAACTTGGACCACGGGAGGGCCT GGGGCATCCTGACTTTCAAAGGGAAGAGTGAGGATACGGCTCGGGAAATCGAGCAAGTCATGTACCACGA TTGGCGTTTGGTACCCAAGCACGAGGAGGAGGCCTTCACTGCGTTCACTGCGAAACCAGAGGACAGATTG AATTCTGTCCCCTATCCACCTCTGCTGCGAGCCATGATCCTCGCTGAACGGCAGAAAAACGGGGATACCA GCGTGCAGGAGCCGCTCCTGAACCTGGAGAGGACTCGAATGCGCCCCTGGGACTACCCTGCAAAACAGGA GACGAAAGGGAGGGCCAAGGGCACCCCAGTCTAACTGCCAGGACTGGCAGAGAGGTCCTGTGAGTCATTT GATGGACGAGTGCCTTTGACTGTGCTAGATCTTCACTTCGGTGGCGAGTTATATCCTACAGCCCTGACAC ATCAGGCAATGAATAATGGGGCAGATGACAGGCTGCTTGGTGTCATTTTCAGGCGGGCCCCTCTCTGATT CCTCGGTCTGGAAATAAACGCCAGGAAACAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_023260 |
Insert Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024336, AAH24336 |
RefSeq Size | 903 bp |
RefSeq ORF | 657 bp |
Locus ID | 79044 |
UniProt ID | Q9JIK9 |
Gene Summary | Required for mitochondrial translation, plays a role in maintaining the stability of the small ribosomal subunit and the 12S rRNA that are required for mitoribosome formation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202465 | Mrps34 (tGFP-tagged) - Mouse mitochondrial ribosomal protein S34 (Mrps34) |
CNY 2,850.00 |
|
MR202465 | Mrps34 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein S34 (Mrps34), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
MR202465L3 | Lenti ORF clone of Mrps34 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein S34 (Mrps34), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
MR202465L4 | Lenti ORF clone of Mrps34 (mGFP-tagged) - Mouse mitochondrial ribosomal protein S34 (Mrps34), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |