United States
Germany
Japan
United Kingdom
China
Cox7b (NM_025379) Mouse Untagged Clone
CAT＃: MC201764
Cox7b (untagged) - Mouse cytochrome c oxidase subunit VIIb (Cox7b), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1100001F07Rik; 1110004F07Rik; C80563 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024350 sequence for NM_025379
TGCAAGGGTAGCTGGGGTGAATTTGCACCAAGGCAGCAGCATAGTCGCCGCAGTTCCATCTTCGTCTCCG CGATGTTGCCCTTAGCCAAAAACGCACTAAGCCGTCTCCAAGTTCGAAGCATTCAGCAAGTGGTGGCAAG GCAGAGCCACCAGAAGAGGGCACCTAGTTTCCATGACAAATATGGGAATGCTATATTAGCAGGTGGAGCC ATCTTCTGTGTTTCTACATGGACATATACAGCCACACAAATTGGAATAGAATGGAACATGTCCCCTGTTG GCAGAGTCACCCCAAAGGAATGGAGAGATCAGTAGTCGTGCCAGCTGGTACAATAATCAAGGAATTGTTT AAAACCAACTTATAAGTGAATGCCAAGTCAAAGAATCATGTACTCATTATACTATGGCAGATTGAAGAAC AAATAAAGAAATAAAGTACCTTAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025379 |
| Insert Size | 243 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024350, AAH24350 |
| RefSeq Size | 460 bp |
| RefSeq ORF | 243 bp |
| Locus ID | 66142 |
| UniProt ID | P56393 |
| Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. Plays a role in proper central nervous system (CNS) development in vertebrates (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200144 | Cox7b (tGFP-tagged) - Mouse cytochrome c oxidase subunit VIIb (Cox7b) |
CNY 2,850.00 |
|
| MR200144 | Cox7b (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIb (Cox7b), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
| MR200144L3 | Lenti ORF clone of Cox7b (Myc-DDK-tagged) - Mouse cytochrome c oxidase subunit VIIb (Cox7b), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR200144L4 | Lenti ORF clone of Cox7b (mGFP-tagged) - Mouse cytochrome c oxidase subunit VIIb (Cox7b), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
