United States
Germany
Japan
United Kingdom
China
Apoa1 (NM_009692) Mouse Untagged Clone
CAT＃: MC201725
Apoa1 (untagged) - Mouse apolipoprotein A-I (Apoa1), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Al; Alp-1; Ap; apo-AI; Apoa-1; apoA-I; Brp-; Brp-14; Ltw-; Ltw-1; Lvtw; Lvtw-1; Se; Sep; Sep-1; Sep-2; Sep2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC019837 sequence for NM_009692
CGGACGCGTGGGCGGAGAGCTCCGGGGAGGTCACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCG TGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATG GGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCC CAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTT CAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGA AACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTG GACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCG AGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATT TCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGC GAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCA AAACCCACCTGAAGACACTTGGCGAGAAAGCCAGACCTGCGCTGGAGGACCTGCGCCATAGTCTGATGCC CATGCTGGAGACGCTTAAGACCAAAGCCCAGAGTGTGATCGACAAGGCCAGCGAGACTCTGACTGCCCAG TGAGGTGCCCGCTTCCACTCCCCACCCCCGCATTGGCTTTCTTACAATAAACCTTTCCAAAATGGAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009692 |
| Insert Size | 795 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC019837, AAH19837 |
| RefSeq Size | 951 bp |
| RefSeq ORF | 795 bp |
| Locus ID | 11806 |
| UniProt ID | Q00623 |
| Gene Summary | This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is the major protein component of plasma high density lipoprotein (HDL). This protein facilitates the removal of cholesterol and other fats from tissues by transporting them to the liver for excretion. This protein is a cofactor for lecithin cholesterolacyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. Mutations in this gene in humans causes familial HDL deficiency, Tangier disease and familial visceral amyloidosis. Similar clinical features are exhibited by mice with mutations in this gene. This gene is clustered with three other apolipoprotein genes on chromosome 9. [provided by RefSeq, Dec 2013] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203500 | Apoa1 (tGFP-tagged) - Mouse apolipoprotein A-I (Apoa1) |
CNY 5,200.00 |
|
| MR203500 | Apoa1 (Myc-DDK-tagged) - Mouse apolipoprotein A-I (Apoa1) |
CNY 3,600.00 |
|
| MR203500L3 | Lenti ORF clone of Apoa1 (Myc-DDK-tagged) - Mouse apolipoprotein A-I (Apoa1) |
CNY 6,000.00 |
|
| MR203500L4 | Lenti ORF clone of Apoa1 (mGFP-tagged) - Mouse apolipoprotein A-I (Apoa1) |
CNY 6,000.00 |
