United States
Germany
Japan
United Kingdom
China
Pomp (NM_025624) Mouse Untagged Clone
CAT＃: MC201555
Pomp (untagged) - Mouse proteasome maturation protein (Pomp), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2510048O06Rik; Ump1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027016 sequence for NM_025624
TTTGGCCGGCGGACTCGAGCAGGTTTATAGATCTCACAGAGCTGTTTCAAAGATGAACGCCAGAGGTCTT GGGTCGGAGCTGAAGGACAGTATTCCAGTCGCGGAGCTCTCAGCCAGCGGGCCTTTCGAGAGTCACGATC TTCTCCGGAAAGGGTTTTCTTGTGTGAAAAATGAACTTTTGCCCAGTCACCCTCTCGAGTTATCAGAAAA AAACTTCCAGCTCAACCAGGACAAGATGAACTTTTCCACGCTGAGGAACATCCAGGGTCTGTTTGCTCCC CTGAAGTTACAGATGGAATTCAAGGCAGTGCAGCAGGTTCACCGTCTCCCGTTTCTCCCGAGCTCAAACC TCTCACTGGATATTTTGAGGGGCAACGATGAGACCATTGGTTTTGAGGATATTCTTAATGATCCATCACA AAGTGAACTGATGGGTGAGCCCCACGTGATGGTGGAACATAAGCTGGGCTTGCTGTAATAAGGGGCCCGC GCAGGGAGGAACGACGAGTGTGCTCAGCATAGTTGCCTGCTACAGTCTGATGTTCACAGCAGTAAAGTAC AGAGAGGATCACTGGGCCATGTGGAAGCATTTGAGGCTTGGTTTTGGGTTGTGGGTCAGTTGAGAGCCTA GAGGTGGTTCTGAGGTTATAGCAAAGCTCAAATTCTGAAAATGTGTGTCTTATAAATGTTATAAAAACGC AATAAAGTCCCCGGGAGTTACCTTGAGAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025624 |
| Insert Size | 426 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027016, AAH27016 |
| RefSeq Size | 742 bp |
| RefSeq ORF | 426 bp |
| Locus ID | 66537 |
| UniProt ID | Q9CQT5 |
| Gene Summary | Molecular chaperone essential for the assembly of standard proteasomes and immunoproteasomes. Degraded after completion of proteasome maturation (By similarity). Mediates the association of 20S preproteasome with the endoplasmic reticulum (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200906 | Pomp (tGFP-tagged) - Mouse proteasome maturation protein (Pomp) |
CNY 2,850.00 |
|
| MR200906 | Pomp (Myc-DDK-tagged) - Mouse proteasome maturation protein (Pomp) |
CNY 1,200.00 |
|
| MR200906L3 | Lenti ORF clone of Pomp (Myc-DDK-tagged) - Mouse proteasome maturation protein (Pomp) |
CNY 4,750.00 |
|
| MR200906L4 | Lenti ORF clone of Pomp (mGFP-tagged) - Mouse proteasome maturation protein (Pomp) |
CNY 4,750.00 |
