Isg15 (NM_015783) Mouse Untagged Clone

CAT#: MC201434

Isg15 (untagged) - Mouse ISG15 ubiquitin-like modifier (Isg15), (10ug)



  "NM_015783" in other vectors (5)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 100038882; G1p2; IGI15; IP17; Irfp; UCRP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031424 sequence for NM_015783
CAGTCTCTGACTGTGAGAGCAAGCAGCCAGAAGCAGACTCCTTAATTCCAGGGGACCTAGAGCTAGAGCC TGCAGCAATGGCCTGGGACCTAAAGGTGAAGATGCTGGGGGGTAACGATTTCCTGGTGTCCGTGACTAAC TCCATGACGGTGTCAGAACTGAAGAAGCAGATTGCCCAGAAGATTGGTGTGCCGGCTTTCCAGCAGCGCC TGGCCCACCAAACTGCAGTGCTCCAGGACGGTCTTACCCTTTCCAGTCTGGGTCTGGGTCCCAGCAGCAC AGTGATGCTAGTGGTACAGAACTGCAGCGAGCCTCTGAGCATCCTGGTGAGGAACGAAAGGGGCCACAGC AACATCTATGAGGTCTTTCTGACGCAGACTGTAGACACGCTTAAGAAGAAGGTGTCCCAGCGGGAACAAG TCCACGAAGACCAGTTCTGGCTGAGCTTCGAGGGAAGGCCCATGGAGGACAAGGAGCTGCTGGGGGAGTA TGGCCTAAAGCCCCAGTGCACAGTGATCAAGCATTTGCGCCTGAGGGGTGGGGGAGGGGACCAGTGTGCC TAAGGCCCCCATCCAGAGCCAGTGTTGGTTATAAAAGATGATGGGGGGGGGGTATGGAGGACTTTTGGGA TAGCATTGGAAATGTAAACGAGGAAAATACCTAATTAGAAAAAATATCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_015783
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC031424, AAH31424
RefSeq Size 694 bp
RefSeq ORF 486 bp
Locus ID 100038882
UniProt ID Q64339
Gene Summary Ubiquitin-like protein which plays a key role in the innate immune response to viral infection either via its conjugation to a target protein (ISGylation) or via its action as a free or unconjugated protein. ISGylation involves a cascade of enzymatic reactions involving E1, E2, and E3 enzymes which catalyze the conjugation of ISG15 to a lysine residue in the target protein. Its target proteins include SERPINA3G/SPI2A, JAK1, MAPK3/ERK1, PLCG1, TRIM25, STAT5A, MAPK1/ERK2 and globin. Can also isgylate: DDX58/RIG-I which inhibits its function in antiviral signaling response and EIF4E2 which enhances its cap structure-binding activity and translation-inhibition activity. Exhibits antiviral activity towards both DNA and RNA viruses, including influenza A and B virus, sindbis virus (SV) and herpes simplex type-1 (HHV-1). Plays a significant role in the control of neonatal Chikungunya virus (CHIKV) infection by acting as a putative immunomodulator of proinflammatory cytokines. Protects mice against the consequences of Chikungunya virus infection by downregulating the pathogenic cytokine response, often denoted as the cytokine storm. Plays a role in erythroid differentiation. The secreted form of ISG15 can: induce natural killer cell proliferation, act as a chemotactic factor for neutrophils and act as a IFN-gamma-inducing cytokine playing an essential role in antimycobacterial immunity. The secreted form acts through the integrin ITGAL/ITGB2 receptor to initiate activation of SRC family tyrosine kinases including LYN, HCK and FGR which leads to secretion of IFNG and IL10; the interaction is mediated by ITGAL (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...