United States
Germany
Japan
United Kingdom
China
Iapp (NM_010491) Mouse Untagged Clone
CAT＃: MC201355
Iapp (untagged) - Mouse islet amyloid polypeptide (Iapp), (10ug)
CNY 1,800.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | DAP |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027527 sequence for NM_010491
CTGAAGCTTCAGGCTGTCAAAGCATTTTCTGATATTGCTGCCTCGGACCACTGAAAGGGATCTTGAGAAA TGATGTGCATCTCCAAACTGCCAGCTGTCCTCCTCATCCTCTCTGTGGCACTGAACCACTTGAGAGCTAC ACCTGTCAGAAGTGGTAGCAACCCTCAGATGGACAAACGGAAGTGCAACACGGCCACGTGTGCCACACAA CGCCTGGCAAACTTTTTGGTTCGTTCCAGCAACAACCTTGGTCCAGTCCTCCCACCAACCAACGTGGGAT CGAATACATATGGCAAGAGGAATGCGGCAGGGGATCCAAATAGGGAATCCTTGGATTTCTTACTCGTTTA AAGTCAATGTACTTCTGCAGCACTTAATACTTTATGTGTAAATGCTCTGGTGATTTCCTGAATATTAACA GTACCTTTTTCATTCCCCCCTCAGTGAGAATGCACAATGTGCTTGTGCTTGATGACTGTGTGTGTAAATT CTCATGCTAAGAATTGCTTTAAACTGAGTATTGATCAAGTTCAGAGTGAAGTCAATGTCTCTAATCACAC ATGTTCTTGCTATACATTTATATTTTAGGGACACTTAAAATTTCTGTTTTTACCTTGTACCTCTATGACT CAAGTTTAACAATAAAGAAGACCATGGGATGATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_010491 |
| Insert Size | 282 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027527, AAH27527 |
| RefSeq Size | 715 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 15874 |
| UniProt ID | P12968 |
| Gene Summary | Selectively inhibits insulin-stimulated glucose utilization and glycogen deposition in muscle, while not affecting adipocyte glucose metabolism.[UniProtKB/Swiss-Prot Function] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Hsp72 (HSPA1A) Prevents Human Islet Amyloid Polypeptide Aggregation and Toxicity: A New Approach for Type 2 Diabetes Treatment
,Rosas, PC;Nagaraja, GM;Kaur, P;Panossian, A;Wickman, G;Garcia, LR;Al-Khamis, FA;Asea, AA;,
PLoS ONE
,PubMed ID 26960140
[IAPP]
|
|
Enhanced thermogenic program by non-viral delivery of combinatory browning genes to treat diet-induced obesity in mice
,Park, H;Cho, S;Janat-Amsbury, MM;Bae, YH;,
Biomaterials
,PubMed ID 26398307
[IAPP]
|
|
Combinatorial gene construct and non-viral delivery for anti-obesity in diet-induced obese mice
,Park, H;Cho, S;Han, YH;Janat-Amsbury, MM;Boudina, S;Bae, YH;,
J Control Release
,PubMed ID 25817008
[Iapp]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200246 | Iapp (tGFP-tagged) - Mouse islet amyloid polypeptide (Iapp) |
CNY 3,400.00 |
|
| MR200246 | Iapp (Myc-DDK-tagged) - Mouse islet amyloid polypeptide (Iapp) |
CNY 1,800.00 |
|
| MR200246L3 | Lenti ORF clone of Iapp (Myc-DDK-tagged) - Mouse islet amyloid polypeptide (Iapp) |
CNY 5,890.00 |
|
| MR200246L4 | Lenti ORF clone of Iapp (mGFP-tagged) - Mouse islet amyloid polypeptide (Iapp) |
CNY 5,890.00 |
