Nqo2 (NM_020282) Mouse Untagged Clone
CAT#: MC201352
Nqo2 (untagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2), transcript variant 1, (10ug)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | NMO2; Nmor2; Ox2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027629 sequence for NM_020282
TAGACACTGGCTGTGTCACATTGTGCGTGTGTTCCCTCCAGGAGGCAGAGGTCCCTGGCTGCATCACCAG CCACTCACTTCAAACCAGAGCCCAGCTAAATAACCTTTCTTGCTGTTTCTTGAACTCTCCAGAGTGCTAC AATAACCAAGGAGAGTAACAGTACCTGAAACTTTTGGCTGTTATACCAAATCAGAGAATCTATCTCCTCC AACATGGCAGGTAAGAAAGTGCTCATCGTCTATGCACACCAAGAACCCAAGTCCTTCAATGGGTCCCTGA AGAAAGTGGCTGTTGAAGAACTGAGCAAGCAGGGATGCACAGTCACTGTGTCTGATTTATATAGCATGAA CTTTGAGCCAAGGGCCACAAGAAATGATATCACTGGTGCCCCCTCTAATCCTGACGTCTTCAGTTATGGG ATAGAAACCCATGAAGCCTACAAGAAGAAAGCTCTGACCAGTGATATATTTGAAGAACAGAGAAAGGTGC AAGAAGCTGATCTTGTGATATTTCAGTTTCCACTATACTGGTTCAGCGTTCCAGCAATCCTAAAAGGTTG GATGGATAGGGTGCTGTGCCGAGGGTTTGCCTTTGATATCCCAGGCTTTTATGACTCTGGTTTTCTCAAG GGTAAATTAGCTCTCCTTTCCTTAACCACGGGAGGTACAGCGGAGATGTACACAAAAGATGGGGTCAGTG GAGATTTCCGGTACTTCCTGTGGCCACTTCAGCATGGTACACTGCACTTCTGTGGATTTAAAGTCCTTGC CCCCCAGATCAGTTTTGGTCTTGATGTTTCATCAGAAGAAGAAAGGAAAGTGATGCTGGCATCATGGGCC CAGCGGCTGAAGAGCATCTGGAAGGAAGAACCCATCCACTGCACACCCCCTTGGTACTTCCAAGAGTAAC ATTTTGTGCTCTGAGTACAGCTGACAAGCAACACAGTGAGAGACCTACAGCATGTGCAAAGAGAAGGTGG TGTTGTATCCTGAGATGTATTTAACAGTGCCCACCAATGAGTGTCTTCAGTTTAATACAACTAGTTCAGA TATTTCAAAAGTCAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_020282 |
Insert Size | 696 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC027629, AAH27629 |
RefSeq Size | 1083 bp |
RefSeq ORF | 696 bp |
Locus ID | 18105 |
UniProt ID | Q9JI75 |
Gene Summary | The enzyme apparently serves as a quinone reductase in connection with conjugation reactions of hydroquinones involved in detoxification pathways as well as in biosynthetic processes such as the vitamin K-dependent gamma-carboxylation of glutamate residues in prothrombin synthesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202793 | Nqo2 (tGFP-tagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2) |
CNY 2,850.00 |
|
MG222397 | Nqo2 (tGFP-tagged) - Mouse NAD(P)H dehydrogenase quinone 2 (Nqo2) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR222397 | Nqo2 (Myc-DDK-tagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2), transcript variant 1 |
CNY 3,840.00 |
|
MR222397L3 | Lenti ORF clone of Nqo2 (Myc-DDK-tagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2), transcript variant 1 |
CNY 4,750.00 |
|
MR222397L4 | Lenti ORF clone of Nqo2 (mGFP-tagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2), transcript variant 1 |
CNY 4,750.00 |