Smdt1 (NM_026914) Mouse Untagged Clone
CAT#: MC201345
Smdt1 (untagged) - Mouse RIKEN cDNA 1500032L24 gene (1500032L24Rik), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500032L24Rik; Emre |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028457 sequence for NM_026914
GCGTGGGGTGTGGCTCCCGGCGAGGGGCGGAGCTGGAGATGGCGTCCACGGCGGCTCGGCGGCTGGCCTG GGTTGCAGTTCGACCCGGGGCTCTCTGGAGCGGGCCGAGGGGGAGGAGAGGTGGCGATGTCTACACCGTA CCGGGCAGCTCAGGTCTCAGCCAGGTACCGTCGAGGTCAGTCATCGTCACTCGCAGCGGCGCCATTTTGC CCAAGCCGGTGAAAATGTCCTTTGGTCTTCTCCGAGTGTTCTCCATTGTGATCCCCTTTCTCTATGTCGG GACACTCATCAGCAAGAACTTCGCTGCTCTGCTTGAGGAACATGACATTTTTGTCCCAGAGGATGACGAC GACGACGATTAACAGGGCACAGGGAGCACAGGAGAAAGCACTGATGATGTGGTGGCATGCTCAGCTCCCT CCCGTCGGCAGAAGGGTCAAGGAAAGCCCTCAGCCTCACCTCCTCATGGTTTGTGACAAGAGCCCAGAGT CCTGTGCTTTGGGAGGCTCCCTCACGGCTGTCCACAGAGTACTGGAAATAACAAGCAAGCAAATTAGGAG TGTATAATAAATGAGTCATGTATGAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_026914 |
Insert Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028457, AAH28457 |
RefSeq Size | 608 bp |
RefSeq ORF | 324 bp |
Locus ID | 69029 |
UniProt ID | Q9DB10 |
Gene Summary | Essential regulatory subunit of the mitochondrial calcium uniporter complex (uniplex), a complex that mediates calcium uptake into mitochondria (PubMed:27001609). Required to bridge the calcium-sensing proteins MICU1 and MICU2 with the calcium-conducting subunit MCU. Plays a central role in regulating the uniplex complex response to intracellular calcium signaling. Acts by mediating activation of MCU and retention of MICU1 to the MCU pore, in order to ensure tight regulation of the uniplex complex and appropriate responses to intracellular calcium signaling (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200382 | 1500032L24Rik (tGFP-tagged) - Mouse RIKEN cDNA 1500032L24 gene (1500032L24Rik) |
CNY 2,850.00 |
|
MR200382 | 1500032L24Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500032L24 gene (1500032L24Rik) |
CNY 1,200.00 |
|
MR200382L3 | Lenti ORF clone of 1500032L24Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500032L24 gene (1500032L24Rik) |
CNY 4,750.00 |
|
MR200382L4 | Lenti ORF clone of 1500032L24Rik (mGFP-tagged) - Mouse RIKEN cDNA 1500032L24 gene (1500032L24Rik) |
CNY 4,750.00 |