Fbxo6 (NM_015797) Mouse Untagged Clone
CAT#: MC201276
Fbxo6 (untagged) - Mouse F-box protein 6 (Fbxo6), transcript variant 1, (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA408845; FBG2; Fbs2; Fbx6b; Fbxo6b |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC017512 sequence for NM_015797
GAGTCCGGCGCCGGGACGCGGGGACGCCGGGCCTGCTGTAGGCACGCGAGGGTCCCGGACGGTGGCGACA CCGGCTTCTCCTTGGGACGCCGGGCTTCAGGCGCTAGGGTCTGGGAACGTAATTCTCTGTTGCCACCATG GTCCACATCAACGAGCTGCCAGAGAACATTCTCCTGGAGCTGTTCATCCATATCCCGGCCCCACAGCTGC TGCGCAACTGCCGCCTGGTCTGCCGCCTCTGGCGAGACCTCATCGATGTGGTGTCCCTATGGAAGCGCAA GAGTCTTCGAGAGGGCTTCTTCACCAAAGACCGGTGCGAGCCCGTGGAAGACTGGAAGGTCTTCTATATC CTGTGCAGCCTGCAGAGGAACCTCCTTCGGAACCCGTGTGCTGAAGAGAACCTGAGCTCATGGCGGATAG ACTCCAACGGAGGGGATCGCTGGAAGGTGGAGACGCTCCCTGGGAGCTGTGGCACAAGCTTTCCTGACAA CAAGGTCAAGAAGTATTTTGTCACCTCTTTTGAGATGTGCCTCAAATCCCAGATGGTGGACCTCAAAGCT GAGGGCTACTGCGAGGAGCTGATGGACACCTTTCGGCCTGACATTGTGGTTAAGGACTGGGTTGCCCCCA GAGCAGACTGTGGCTGCACCTATCAACTCCGGGTACAGCTGGCCTCTGCGGACTACATTGTCTTGGCCTC TTTTGAGCCTCCACCTGTGACATTCCAACAGTGGAATGATGCCAAATGGCAAGAGATTTCCCACACCTTC TCTGATTACCCTCCAGGTGTCCGTCACATCCTTTTTCAACACGGGGGCCAGGACACTCAGTTCTGGAAAG GCTGGTACGGCCCCCGTGTCACCAACAGCAGCATCATTATCAGCCACAGGACAGCCAAGAACCCTCCCCC TGCCAGAACTCTACCGGAAGAAACTGTAGTAATCGGAAGGAGACGGCGAGCTTCGGACTCCAACACTCAT GAGGGTTTCTTCTGGCAAGGGCTATGGCAAAGGCTAAGGCGTTAGTGGGCAGTCAGGCTCCCAGTCCCAT GAGCACTTGCCCTATACAACCTTGGGCAAGCCCATCAACTCAGTAGTGATAGTTGGCACCCACAGCTCTG ACATTTTGTTGTAATAAATGTTTTCAGTAACCCAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_015797 |
Insert Size | 888 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC017512, AAH17512 |
RefSeq Size | 1175 bp |
RefSeq ORF | 888 bp |
Locus ID | 50762 |
UniProt ID | Q9QZN4 |
Gene Summary | Substrate-recognition component of some SCF (SKP1-CUL1-F-box protein)-type E3 ubiquitin ligase complexes. Involved in DNA damage response by specifically recognizing activated CHEK1 (phosphorylated on 'Ser-345'), promoting its ubiquitination and degradation. Ubiquitination of CHEK1 is required to insure that activated CHEK1 does not accumulate as cells progress through S phase, or when replication forks encounter transient impediments during normal DNA replication (By similarity). Involved in endoplasmic reticulum-associated degradation pathway (ERAD) for misfolded lumenal proteins by recognizing and binding sugar chains on unfolded glycoproteins that are retrotranslocated into the cytosol and promoting their ubiquitination and subsequent degradation. Able to recognize and bind denatured glycoproteins, which are modified with not only high-mannose but also complex-type oligosaccharides. Also recognizes sulfated glycans.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-6 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204081 | Fbxo6 (tGFP-tagged) - Mouse F-box protein 6 (Fbxo6) |
CNY 2,850.00 |
|
MG219089 | Fbxo6 (tGFP-tagged) - Mouse F-box protein 6 (Fbxo6) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR219089 | Fbxo6 (Myc-DDK-tagged) - Mouse F-box protein 6 (Fbxo6), transcript variant 1 |
CNY 2,400.00 |
|
MR219089L3 | Lenti ORF clone of Fbxo6 (Myc-DDK-tagged) - Mouse F-box protein 6 (Fbxo6), transcript variant 1 |
CNY 4,750.00 |
|
MR219089L4 | Lenti ORF clone of Fbxo6 (mGFP-tagged) - Mouse F-box protein 6 (Fbxo6), transcript variant 1 |
CNY 4,750.00 |